\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125022392:

Variant ID: vg1125022392 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25022392
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATCCGCGAGGAGGAGGTCGGCCGGCTGCTCCGGGCGGTGGCGGCGGCCTCGCCGGCGCGGCGCGCCGTGAACCTTAGCGAGCTCATTTCGGCCTACTC[G/A]
GCTGACTCGACGATGCGCGCCCTAATAGGGAGCCGGTTCAAGGACCGGGACAGGTTCTTGATGCTGCTAGAGCGCGGTGTGAAGCTATTCGCCACGCCGA

Reverse complement sequence

TCGGCGTGGCGAATAGCTTCACACCGCGCTCTAGCAGCATCAAGAACCTGTCCCGGTCCTTGAACCGGCTCCCTATTAGGGCGCGCATCGTCGAGTCAGC[C/T]
GAGTAGGCCGAAATGAGCTCGCTAAGGTTCACGGCGCGCCGCGCCGGCGAGGCCGCCGCCACCGCCCGGAGCAGCCGGCCGACCTCCTCCTCGCGGATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 2.30% 2.50% 2.75% NA
All Indica  2759 96.70% 0.10% 0.36% 2.75% NA
All Japonica  1512 85.90% 6.80% 7.08% 0.20% NA
Aus  269 87.00% 0.40% 0.37% 12.27% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 92.00% 0.00% 0.22% 7.74% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 93.80% 0.50% 0.89% 4.83% NA
Temperate Japonica  767 75.20% 12.60% 11.86% 0.26% NA
Tropical Japonica  504 98.20% 0.20% 1.59% 0.00% NA
Japonica Intermediate  241 94.20% 2.10% 3.32% 0.41% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 94.40% 2.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125022392 G -> A LOC_Os11g41680.1 synonymous_variant ; p.Ser217Ser; LOW synonymous_codon Average:72.889; most accessible tissue: Minghui63 young leaf, score: 90.072 N N N N
vg1125022392 G -> DEL LOC_Os11g41680.1 N frameshift_variant Average:72.889; most accessible tissue: Minghui63 young leaf, score: 90.072 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125022392 G A -0.02 -0.01 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125022392 4.29E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 9.26E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 4.53E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 4.17E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 2.33E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 4.29E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 1.96E-09 NA mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 4.15E-10 4.15E-10 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 5.95E-08 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 2.09E-06 1.66E-06 mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.76E-08 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 6.91E-07 4.82E-09 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 3.80E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 7.46E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 6.94E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 1.08E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.49E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 8.94E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.79E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 4.90E-07 4.90E-07 mr1609_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.84E-09 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.47E-07 1.87E-07 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 3.71E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 1.51E-06 1.97E-07 mr1900_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 8.24E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125022392 NA 7.60E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251