Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123325178:

Variant ID: vg1123325178 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23325178
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATTCTGAATAAAAATCATTGATCTCAACATCGGATAAGTTCTCATGAGTAAATATTTCCACAAAAATCTTGCAATGCAACCAAAGATCTACTTCATC[T/C]
AAGGATTTTAAATTTTCAGAGTTGAACAAAAACCCAAAAACATTATCAAATGCTTTCATCTGCTCAAATATATTAGTCAGTGAAGCAATTGCAGCATCAA

Reverse complement sequence

TTGATGCTGCAATTGCTTCACTGACTAATATATTTGAGCAGATGAAAGCATTTGATAATGTTTTTGGGTTTTTGTTCAACTCTGAAAATTTAAAATCCTT[A/G]
GATGAAGTAGATCTTTGGTTGCATTGCAAGATTTTTGTGGAAATATTTACTCATGAGAACTTATCCGATGTTGAGATCAATGATTTTTATTCAGAATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 9.40% 2.31% 45.51% NA
All Indica  2759 46.40% 1.00% 3.12% 49.51% NA
All Japonica  1512 34.40% 26.60% 0.79% 38.23% NA
Aus  269 54.30% 1.50% 2.23% 42.01% NA
Indica I  595 59.20% 2.40% 1.68% 36.81% NA
Indica II  465 62.40% 1.30% 2.80% 33.55% NA
Indica III  913 25.30% 0.10% 2.74% 71.85% NA
Indica Intermediate  786 51.70% 0.90% 4.83% 42.62% NA
Temperate Japonica  767 20.50% 45.50% 0.65% 33.38% NA
Tropical Japonica  504 54.00% 6.70% 0.79% 38.49% NA
Japonica Intermediate  241 37.80% 7.90% 1.24% 53.11% NA
VI/Aromatic  96 33.30% 3.10% 3.12% 60.42% NA
Intermediate  90 52.20% 5.60% 2.22% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123325178 T -> DEL N N silent_mutation Average:53.742; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1123325178 T -> C LOC_Os11g39170-LOC_Os11g39190 intergenic_region ; MODIFIER silent_mutation Average:53.742; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123325178 2.89E-08 1.11E-31 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123325178 NA 2.01E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123325178 NA 3.50E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123325178 NA 1.98E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123325178 NA 1.74E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251