Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123023188:

Variant ID: vg1123023188 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23023188
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGTTCGTGAAGGCTTCAAGGTACCGAGGGCCGAAAAACAGTTTGTGAAGGCTCCAAGGTGCGCTTCATTGAGAAGGGGATACATCTTTTCTTCTTTAT[C/A]
ATCCAAGAATTGGCACACTTCGACGACATCATCAAGACTTTGGAGATAGGCTAATATTTAGTTTGTGTTCTCATGTTTAGTTTACACTCCAAATGCAATA

Reverse complement sequence

TATTGCATTTGGAGTGTAAACTAAACATGAGAACACAAACTAAATATTAGCCTATCTCCAAAGTCTTGATGATGTCGTCGAAGTGTGCCAATTCTTGGAT[G/T]
ATAAAGAAGAAAAGATGTATCCCCTTCTCAATGAAGCGCACCTTGGAGCCTTCACAAACTGTTTTTCGGCCCTCGGTACCTTGAAGCCTTCACGAACCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 3.90% 0.13% 2.86% NA
All Indica  2759 95.10% 1.30% 0.18% 3.44% NA
All Japonica  1512 98.90% 0.90% 0.00% 0.20% NA
Aus  269 40.10% 47.20% 0.37% 12.27% NA
Indica I  595 99.20% 0.20% 0.17% 0.50% NA
Indica II  465 98.70% 0.00% 0.00% 1.29% NA
Indica III  913 88.40% 3.10% 0.22% 8.32% NA
Indica Intermediate  786 97.60% 0.90% 0.25% 1.27% NA
Temperate Japonica  767 99.00% 0.90% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 0.00% 2.08% NA
Intermediate  90 94.40% 3.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123023188 C -> A LOC_Os11g38750-LOC_Os11g38760 intergenic_region ; MODIFIER silent_mutation Average:44.578; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg1123023188 C -> DEL N N silent_mutation Average:44.578; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123023188 NA 2.80E-08 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123023188 NA 3.09E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123023188 NA 2.21E-08 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123023188 NA 4.97E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251