\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121711093:

Variant ID: vg1121711093 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21711093
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAAACTCAGGGTGAAAAATAATTAGATTTAGGGCTTTGGGCGTGAGATTTTGCACGGCTCTCGTAGAAACTCCTATAAAACTAGAAAACATCGCGCAC[G/A]
CACGTTGGTGTGGGTTTGATTGTCCTGTCATTGTCATTTAATATTATCGTTTAAAAATATGTACCTTTTTTACTTTGGTATTTATTTTGGAACTAATGTA

Reverse complement sequence

TACATTAGTTCCAAAATAAATACCAAAGTAAAAAAGGTACATATTTTTAAACGATAATATTAAATGACAATGACAGGACAATCAAACCCACACCAACGTG[C/T]
GTGCGCGATGTTTTCTAGTTTTATAGGAGTTTCTACGAGAGCCGTGCAAAATCTCACGCCCAAAGCCCTAAATCTAATTATTTTTCACCCTGAGTTTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.70% 1.25% 0.00% NA
All Indica  2759 99.80% 0.00% 0.18% 0.00% NA
All Japonica  1512 88.10% 8.40% 3.51% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.38% 0.00% NA
Temperate Japonica  767 78.20% 15.30% 6.52% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 2.90% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121711093 G -> A LOC_Os11g36770.1 upstream_gene_variant ; 336.0bp to feature; MODIFIER silent_mutation Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg1121711093 G -> A LOC_Os11g36760.1 downstream_gene_variant ; 3064.0bp to feature; MODIFIER silent_mutation Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg1121711093 G -> A LOC_Os11g36760-LOC_Os11g36770 intergenic_region ; MODIFIER silent_mutation Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121711093 NA 3.11E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 2.33E-08 2.33E-08 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 1.25E-06 5.76E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 5.47E-07 2.37E-12 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 1.75E-06 2.00E-08 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 3.05E-10 3.05E-10 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 8.66E-06 1.63E-09 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 3.24E-06 9.41E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 2.28E-06 1.77E-13 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 3.96E-07 9.41E-13 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 4.64E-07 4.64E-07 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 6.34E-06 6.34E-06 mr1703 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 1.86E-06 6.63E-11 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 NA 9.85E-07 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 NA 3.89E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 NA 1.76E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 NA 9.08E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093 NA 1.54E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251