\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121250029:

Variant ID: vg1121250029 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21250029
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATTTGTATAAAAAATTTGAACAAAATGAATGATCAAACGTTGTTCAACAAATCAATGGCGTCATACATTAAAATTAAAATAGGGAGGGAGGGAGGGAG[T/C]
AGTAGTTGTTTGTTAACAGACCTGCCATGTAATTAATTAAGTTGGCCACACTTCATACAGACAAAAAAAGCTGCATAACATGGATGATGATACCCTTGAT

Reverse complement sequence

ATCAAGGGTATCATCATCCATGTTATGCAGCTTTTTTTGTCTGTATGAAGTGTGGCCAACTTAATTAATTACATGGCAGGTCTGTTAACAAACAACTACT[A/G]
CTCCCTCCCTCCCTCCCTATTTTAATTTTAATGTATGACGCCATTGATTTGTTGAACAACGTTTGATCATTCATTTTGTTCAAATTTTTTATACAAATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 20.40% 0.21% 0.70% NA
All Indica  2759 86.80% 12.80% 0.18% 0.22% NA
All Japonica  1512 67.50% 32.30% 0.13% 0.07% NA
Aus  269 79.90% 10.80% 0.37% 8.92% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 72.10% 27.30% 0.33% 0.33% NA
Indica Intermediate  786 89.80% 9.70% 0.13% 0.38% NA
Temperate Japonica  767 81.20% 18.80% 0.00% 0.00% NA
Tropical Japonica  504 56.70% 42.90% 0.40% 0.00% NA
Japonica Intermediate  241 46.50% 53.10% 0.00% 0.41% NA
VI/Aromatic  96 21.90% 76.00% 1.04% 1.04% NA
Intermediate  90 72.20% 25.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121250029 T -> DEL N N silent_mutation Average:44.088; most accessible tissue: Callus, score: 78.61 N N N N
vg1121250029 T -> C LOC_Os11g36140.1 upstream_gene_variant ; 3214.0bp to feature; MODIFIER silent_mutation Average:44.088; most accessible tissue: Callus, score: 78.61 N N N N
vg1121250029 T -> C LOC_Os11g36150.1 downstream_gene_variant ; 826.0bp to feature; MODIFIER silent_mutation Average:44.088; most accessible tissue: Callus, score: 78.61 N N N N
vg1121250029 T -> C LOC_Os11g36140-LOC_Os11g36150 intergenic_region ; MODIFIER silent_mutation Average:44.088; most accessible tissue: Callus, score: 78.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121250029 NA 4.10E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 1.52E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 3.61E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 5.66E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 2.02E-06 2.01E-06 mr1497 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 7.79E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 6.30E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 4.85E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 2.03E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 1.75E-06 NA mr1763 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 2.34E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 1.08E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 2.09E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 2.14E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 3.45E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 2.42E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029 NA 8.03E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251