Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121250029:

Variant ID: vg1121250029 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21250029
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATTTGTATAAAAAATTTGAACAAAATGAATGATCAAACGTTGTTCAACAAATCAATGGCGTCATACATTAAAATTAAAATAGGGAGGGAGGGAGGGAG[T/C]
AGTAGTTGTTTGTTAACAGACCTGCCATGTAATTAATTAAGTTGGCCACACTTCATACAGACAAAAAAAGCTGCATAACATGGATGATGATACCCTTGAT

Reverse complement sequence

ATCAAGGGTATCATCATCCATGTTATGCAGCTTTTTTTGTCTGTATGAAGTGTGGCCAACTTAATTAATTACATGGCAGGTCTGTTAACAAACAACTACT[A/G]
CTCCCTCCCTCCCTCCCTATTTTAATTTTAATGTATGACGCCATTGATTTGTTGAACAACGTTTGATCATTCATTTTGTTCAAATTTTTTATACAAATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	20.40%	0.21%	0.70%	NA
All Indica	2759	86.80%	12.80%	0.18%	0.22%	NA
All Japonica	1512	67.50%	32.30%	0.13%	0.07%	NA
Aus	269	79.90%	10.80%	0.37%	8.92%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	72.10%	27.30%	0.33%	0.33%	NA
Indica Intermediate	786	89.80%	9.70%	0.13%	0.38%	NA
Temperate Japonica	767	81.20%	18.80%	0.00%	0.00%	NA
Tropical Japonica	504	56.70%	42.90%	0.40%	0.00%	NA
Japonica Intermediate	241	46.50%	53.10%	0.00%	0.41%	NA
VI/Aromatic	96	21.90%	76.00%	1.04%	1.04%	NA
Intermediate	90	72.20%	25.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121250029	T -> DEL	N	N	silent_mutation	Average:44.088; most accessible tissue: Callus, score: 78.61	N	N	N	N
vg1121250029	T -> C	LOC_Os11g36140.1	upstream_gene_variant ; 3214.0bp to feature; MODIFIER	silent_mutation	Average:44.088; most accessible tissue: Callus, score: 78.61	N	N	N	N
vg1121250029	T -> C	LOC_Os11g36150.1	downstream_gene_variant ; 826.0bp to feature; MODIFIER	silent_mutation	Average:44.088; most accessible tissue: Callus, score: 78.61	N	N	N	N
vg1121250029	T -> C	LOC_Os11g36140-LOC_Os11g36150	intergenic_region ; MODIFIER	silent_mutation	Average:44.088; most accessible tissue: Callus, score: 78.61	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121250029	NA	4.10E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	1.52E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	3.61E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	5.66E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	2.02E-06	2.01E-06	mr1497	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	7.79E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	6.30E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	4.85E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	2.03E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	1.75E-06	NA	mr1763	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	2.34E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	1.08E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	2.09E-06	mr1809	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	2.14E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	3.45E-08	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	2.42E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121250029	NA	8.03E-09	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251