\
| Variant ID: vg1119485334 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19485334 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACATTTTTTAAAACTTGAAAGGATATATCAGCAGATTATTATCTAACTTAAAGTTAATTATATAACTTGTTTTGCTAACTTGTTTAGTTTGTTTTGCAGA[T/G]
TTGACTGAGAAAAAATGATTATTGTTCTAGTGTATGTTGATGGGAGAATACAATATGGAGCTAAGGGTGCAGAATATAATATTCCTCCAAAAATAACTTT
AAAGTTATTTTTGGAGGAATATTATATTCTGCACCCTTAGCTCCATATTGTATTCTCCCATCAACATACACTAGAACAATAATCATTTTTTCTCAGTCAA[A/C]
TCTGCAAAACAAACTAAACAAGTTAGCAAAACAAGTTATATAATTAACTTTAAGTTAGATAATAATCTGCTGATATATCCTTTCAAGTTTTAAAAAATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 31.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 11.30% | 88.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 25.30% | 74.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119485334 | T -> G | LOC_Os11g32960.1 | upstream_gene_variant ; 1106.0bp to feature; MODIFIER | silent_mutation | Average:14.289; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1119485334 | T -> G | LOC_Os11g32970.1 | upstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:14.289; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1119485334 | T -> G | LOC_Os11g32980.1 | downstream_gene_variant ; 3363.0bp to feature; MODIFIER | silent_mutation | Average:14.289; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1119485334 | T -> G | LOC_Os11g32960-LOC_Os11g32970 | intergenic_region ; MODIFIER | silent_mutation | Average:14.289; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119485334 | NA | 3.70E-70 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.69E-26 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.65E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 8.80E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.82E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.54E-34 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.25E-12 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.70E-45 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.93E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 9.76E-22 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 9.52E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.74E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.93E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.15E-25 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.40E-86 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.87E-81 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.07E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.35E-45 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.32E-50 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.11E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 4.40E-44 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.04E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.23E-15 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.77E-23 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.06E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.98E-06 | mr1231 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.14E-12 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.71E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.19E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.66E-30 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.23E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.03E-16 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.51E-10 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.97E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.59E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.68E-17 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.10E-16 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.41E-28 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.01E-16 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.88E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.52E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.60E-08 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.52E-30 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.16E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.68E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.01E-16 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 4.87E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.33E-10 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.79E-93 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 1.65E-06 | 7.51E-11 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 5.11E-06 | 7.10E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 8.76E-07 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.51E-40 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.98E-09 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 4.00E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.76E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.20E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 2.48E-06 | NA | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.62E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.02E-27 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 4.86E-06 | NA | mr1635 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.12E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.59E-16 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.89E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 4.91E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 4.21E-06 | NA | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 1.67E-06 | 1.67E-06 | mr1655 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.72E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.77E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 9.58E-07 | 6.83E-42 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.02E-90 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.94E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.52E-13 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.10E-64 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 8.37E-25 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.84E-62 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.65E-27 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.14E-24 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 4.30E-07 | NA | mr1763 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.61E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.46E-20 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.04E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.18E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.19E-08 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.93E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.93E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 7.54E-06 | NA | mr1809 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.03E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.03E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.53E-22 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.33E-24 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.24E-21 | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.79E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.48E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 6.21E-08 | NA | mr1876 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | 2.79E-06 | 2.79E-06 | mr1876 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 8.51E-38 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.17E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 2.43E-16 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.40E-25 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 1.81E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 3.59E-14 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 6.46E-34 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 5.51E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119485334 | NA | 7.06E-101 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |