Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1110517362:

Variant ID: vg1110517362 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10517362
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTGATTGAGGAGTCAATCACAAGTTATATAATCTATCACAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAAT[T/C]
GATATCGTGGCAAAAGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGACCGGTGGGTCAATACATTCTGCTAGGGGCCGC

Reverse complement sequence

GCGGCCCCTAGCAGAATGTATTGACCCACCGGTCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCTTTTGCCACGATATC[A/G]
ATTAAGCTCAAGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACCTGTGATAGATTATATAACTTGTGATTGACTCCTCAATCACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 8.10% 1.12% 54.27% NA
All Indica  2759 7.80% 11.90% 1.34% 78.91% NA
All Japonica  1512 93.70% 2.70% 0.07% 3.51% NA
Aus  269 7.10% 1.90% 3.35% 87.73% NA
Indica I  595 6.60% 19.30% 0.84% 73.28% NA
Indica II  465 4.50% 4.10% 0.65% 90.75% NA
Indica III  913 2.80% 12.00% 1.31% 83.79% NA
Indica Intermediate  786 16.50% 10.80% 2.16% 70.48% NA
Temperate Japonica  767 96.20% 3.40% 0.00% 0.39% NA
Tropical Japonica  504 88.90% 2.80% 0.20% 8.13% NA
Japonica Intermediate  241 95.90% 0.40% 0.00% 3.73% NA
VI/Aromatic  96 43.80% 2.10% 3.12% 51.04% NA
Intermediate  90 35.60% 5.60% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110517362 T -> DEL N N silent_mutation Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1110517362 T -> C LOC_Os11g18640.1 upstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1110517362 T -> C LOC_Os11g18630.1 downstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1110517362 T -> C LOC_Os11g18630-LOC_Os11g18640 intergenic_region ; MODIFIER silent_mutation Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110517362 7.22E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 1.06E-07 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 4.94E-08 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 6.51E-06 NA mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 2.57E-06 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 7.55E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 2.14E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 NA 6.98E-06 mr1809 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 5.62E-06 NA mr1820 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 2.70E-06 NA mr1820 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362 3.11E-06 NA mr1876 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251