Search for Variation information by Variation ID:
Detailed information for vg1109530315:
| Variant ID: vg1109530315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9530315 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 57. )
Flanking Sequence (100 bp) in Reference Genome:
GAGGAAGAAAACCGCAAGAAATATAATCTTCGACCGTAACCATACGGCCTAAGATGGGTTCGGGTTCAATACCTCCTATCTCCCTCTGCATGGTCCCGCG[G/A]
CCAGGGAGGGTGCCGTCGTCCTGCAACTTCTTCAGGGATGCGGTGGTGGAGGTGGACTTGTCGATATCCATCGCCGCCGGAGGATCGCCGGAGAGTAAAG
Reverse complement sequence
CTTTACTCTCCGGCGATCCTCCGGCGGCGATGGATATCGACAAGTCCACCTCCACCACCGCATCCCTGAAGAAGTTGCAGGACGACGGCACCCTCCCTGG[C/T]
CGCGGGACCATGCAGAGGGAGATAGGAGGTATTGAACCCGAACCCATCTTAGGCCGTATGGTTACGGTCGAAGATTATATTTCTTGCGGTTTTCTTCCTC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 13.70% | 4.76% | 46.34% | NA |
| All Indica | 2759 | 5.40% | 23.10% | 7.07% | 64.48% | NA |
| All Japonica | 1512 | 95.80% | 0.10% | 0.33% | 3.77% | NA |
| Aus | 269 | 4.80% | 1.50% | 7.81% | 85.87% | NA |
| Indica I | 595 | 8.90% | 15.60% | 3.19% | 72.27% | NA |
| Indica II | 465 | 4.10% | 17.00% | 5.81% | 73.12% | NA |
| Indica III | 913 | 2.20% | 34.70% | 11.50% | 51.59% | NA |
| Indica Intermediate | 786 | 7.30% | 18.70% | 5.60% | 68.45% | NA |
| Temperate Japonica | 767 | 97.10% | 0.30% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 94.00% | 0.00% | 0.60% | 5.36% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 18.80% | 0.00% | 1.04% | 80.21% | NA |
| Intermediate | 90 | 41.10% | 4.40% | 3.33% | 51.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109530315 | G -> A | LOC_Os11g17160.1 | synonymous_variant ; p.Gly24Gly; LOW | synonymous_codon | Average:19.768; most accessible tissue: Callus, score: 33.411 | N | N | N | N |
| vg1109530315 | G -> A | LOC_Os11g17160.1 | synonymous_variant ; p.Gly24Gly; LOW | nonsynonymous_codon ; G24D | Average:19.768; most accessible tissue: Callus, score: 33.411 | possibly damaging  |
1.926 |
DELETERIOUS | 0.01 |
| vg1109530315 | G -> DEL | LOC_Os11g17160.1 | N | frameshift_variant | Average:19.768; most accessible tissue: Callus, score: 33.411 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109530315 | NA | 5.89E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 1.52E-06 | mr1243_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 7.95E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | 7.44E-07 | NA | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 8.53E-06 | mr1559_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | 1.42E-06 | 5.43E-07 | mr1745_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 6.71E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | 4.91E-06 | 4.91E-06 | mr1781_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 7.72E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530315 | NA | 4.17E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |