Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1105411517:

Variant ID: vg1105411517 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5411517
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCACAAAGAAGCTCTCTCTAAGATGGGTTTCACTACTTTCTAATAATATTTCAATTTATTTTATTATTTTAGTTATCGAATCAAAAGGTATTTCACC[C/T]
TTCTCTTTGTTTTCTTCTCCTCTACTCCATCCATTAAAAAAATAACTAACCTCGTATTAGAAACTATATCCAGATGTCACATTCTAGTACGAGATTAATT

Reverse complement sequence

AATTAATCTCGTACTAGAATGTGACATCTGGATATAGTTTCTAATACGAGGTTAGTTATTTTTTTAATGGATGGAGTAGAGGAGAAGAAAACAAAGAGAA[G/A]
GGTGAAATACCTTTTGATTCGATAACTAAAATAATAAAATAAATTGAAATATTATTAGAAAGTAGTGAAACCCATCTTAGAGAGAGCTTCTTTGTGGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 30.40% 0.11% 0.00% NA
All Indica  2759 59.50% 40.30% 0.18% 0.00% NA
All Japonica  1512 96.20% 3.80% 0.00% 0.00% NA
Aus  269 11.50% 88.50% 0.00% 0.00% NA
Indica I  595 55.30% 44.50% 0.17% 0.00% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 50.40% 49.40% 0.22% 0.00% NA
Indica Intermediate  786 56.70% 43.00% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105411517 C -> T LOC_Os11g10060.1 downstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:72.886; most accessible tissue: Callus, score: 94.04 N N N N
vg1105411517 C -> T LOC_Os11g10060-LOC_Os11g10070 intergenic_region ; MODIFIER silent_mutation Average:72.886; most accessible tissue: Callus, score: 94.04 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105411517 C T -0.02 -0.01 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105411517 NA 3.28E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 1.13E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 8.70E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 6.97E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 8.17E-06 NA mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 5.04E-08 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 6.02E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105411517 NA 3.15E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251