\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100988118:

Variant ID: vg1100988118 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 988118
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGAGATCGAAGGTGACAAGACAAAAAGGTTGCTTAAGGGCAAAGCTGGTACATCTGCCTCAATAAATATGGTTTTCATGTTACCTGCAGAATTCGAG[G/A]
CTAGGCAAGCCGATGTTGATGATGTTGAAGAAGCTTCGGCTAAATTGGTTTGTCTCGAGAGCAAGCAGTTTTTGAGAAGCCAGAAGGGACAGAGAATCGA

Reverse complement sequence

TCGATTCTCTGTCCCTTCTGGCTTCTCAAAAACTGCTTGCTCTCGAGACAAACCAATTTAGCCGAAGCTTCTTCAACATCATCAACATCGGCTTGCCTAG[C/T]
CTCGAATTCTGCAGGTAACATGAAAACCATATTTATTGAGGCAGATGTACCAGCTTTGCCCTTAAGCAACCTTTTTGTCTTGTCACCTTCGATCTCATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 35.90% 1.33% 2.43% NA
All Indica  2759 93.00% 4.00% 1.70% 1.34% NA
All Japonica  1512 2.00% 97.70% 0.13% 0.20% NA
Aus  269 56.50% 14.10% 4.09% 25.28% NA
Indica I  595 97.10% 1.00% 1.51% 0.34% NA
Indica II  465 84.30% 12.70% 1.51% 1.51% NA
Indica III  913 96.90% 0.50% 1.53% 0.99% NA
Indica Intermediate  786 90.50% 5.00% 2.16% 2.42% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.20% 0.20% NA
Japonica Intermediate  241 2.50% 96.30% 0.41% 0.83% NA
VI/Aromatic  96 68.80% 25.00% 1.04% 5.21% NA
Intermediate  90 40.00% 55.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1100988118 G -> A LOC_Os11g02880.1 downstream_gene_variant ; 4171.0bp to feature; MODIFIER silent_mutation Average:40.369; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg1100988118 G -> A LOC_Os11g02890.1 intron_variant ; MODIFIER silent_mutation Average:40.369; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg1100988118 G -> DEL N N silent_mutation Average:40.369; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1100988118 NA 7.79E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.13E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 4.76E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.23E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.67E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 5.89E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.09E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 3.32E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 5.45E-08 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 3.14E-07 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 6.16E-33 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.06E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 4.45E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.15E-23 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 2.60E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 2.86E-07 2.52E-07 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.37E-27 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.72E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 3.38E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 7.18E-10 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 2.67E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 6.91E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.87E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 7.17E-06 NA mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.64E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 2.96E-06 NA mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 9.03E-07 NA mr1758 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 2.96E-06 6.16E-10 mr1805 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 1.03E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 2.09E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100988118 NA 5.61E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251