Search for Variation information by Variation ID:
Detailed information for vg1016919267:
| Variant ID: vg1016919267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16919267 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )
Flanking Sequence (100 bp) in Reference Genome:
TTCAATGATGATGGTGTGGACTCAAGTCGGCGAAATCGTCTTCCCAGTTTACACCACGATGCCGATCTCAACCGGTCCGCCAATGACCGGAAACGAGAAT[G/A]
CAGTGGCTACAAACCAAGGCGACTCCATGTCGAAAAATCCTCCCACCAAGATGGAGAACGGAGCATCGTCGACATCTGACCTCGAGAAGGATTCTGATGC
Reverse complement sequence
GCATCAGAATCCTTCTCGAGGTCAGATGTCGACGATGCTCCGTTCTCCATCTTGGTGGGAGGATTTTTCGACATGGAGTCGCCTTGGTTTGTAGCCACTG[C/T]
ATTCTCGTTTCCGGTCATTGGCGGACCGGTTGAGATCGGCATCGTGGTGTAAACTGGGAAGACGATTTCGCCGACTTGAGTCCACACCATCATCATTGAA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 42.10% | 0.95% | 3.43% | NA |
| All Indica | 2759 | 27.20% | 66.00% | 1.38% | 5.44% | NA |
| All Japonica | 1512 | 92.90% | 6.90% | 0.13% | 0.13% | NA |
| Aus | 269 | 85.10% | 9.70% | 1.86% | 3.35% | NA |
| Indica I | 595 | 33.10% | 59.50% | 1.68% | 5.71% | NA |
| Indica II | 465 | 19.60% | 75.70% | 0.65% | 4.09% | NA |
| Indica III | 913 | 25.60% | 66.20% | 1.64% | 6.57% | NA |
| Indica Intermediate | 786 | 29.10% | 64.90% | 1.27% | 4.71% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 27.40% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 0.00% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016919267 | G -> A | LOC_Os10g32210.1 | missense_variant ; p.Ala15Thr; MODERATE | nonsynonymous_codon ; A15T | Average:36.723; most accessible tissue: Zhenshan97 root, score: 55.432 | benign  |
0.577 |
TOLERATED | 0.09 |
| vg1016919267 | G -> DEL | LOC_Os10g32210.1 | N | frameshift_variant | Average:36.723; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016919267 | NA | 7.59E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 9.93E-06 | mr1263 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 1.64E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 3.86E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 2.49E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | 6.44E-06 | 6.44E-06 | mr1351 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 2.43E-06 | mr1432 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 9.93E-06 | mr1451 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 4.07E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016919267 | NA | 6.93E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |