Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012367119:

Variant ID: vg1012367119 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12367119
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.04, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TAAACCTCCAAGGCAACAACAAACAGAGAACGAAGTTCTATGAAATTTTGGACTTTCCGAGACATCGGACTATCTGATGTTAAATCGGAGTATCCGATAT[T/A]
TTAGAAGCAAAAACTTCGTCCTCAAACAGAGACTCAAGTTCCATGAAATTTCAGAGTCTCTGTGTCATCGGACTATCTGATCCGACATTGGATACTCTGA

Reverse complement sequence

TCAGAGTATCCAATGTCGGATCAGATAGTCCGATGACACAGAGACTCTGAAATTTCATGGAACTTGAGTCTCTGTTTGAGGACGAAGTTTTTGCTTCTAA[A/T]
ATATCGGATACTCCGATTTAACATCAGATAGTCCGATGTCTCGGAAAGTCCAAAATTTCATAGAACTTCGTTCTCTGTTTGTTGTTGCCTTGGAGGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	16.40%	0.13%	0.00%	NA
All Indica	2759	73.30%	26.60%	0.18%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	93.30%	6.60%	0.17%	0.00%	NA
Indica II	465	67.10%	32.50%	0.43%	0.00%	NA
Indica III	913	68.20%	31.80%	0.00%	0.00%	NA
Indica Intermediate	786	67.60%	32.20%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012367119	T -> A	LOC_Os10g24120.1	upstream_gene_variant ; 4283.0bp to feature; MODIFIER	silent_mutation	Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg1012367119	T -> A	LOC_Os10g24140.1	upstream_gene_variant ; 2109.0bp to feature; MODIFIER	silent_mutation	Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg1012367119	T -> A	LOC_Os10g24150.1	downstream_gene_variant ; 2294.0bp to feature; MODIFIER	silent_mutation	Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg1012367119	T -> A	LOC_Os10g24140-LOC_Os10g24150	intergenic_region ; MODIFIER	silent_mutation	Average:28.367; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012367119	NA	3.12E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	1.10E-06	3.39E-08	mr1157	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	3.83E-06	1.30E-10	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	2.24E-07	1.83E-10	mr1328	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	NA	2.45E-10	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	4.79E-07	1.47E-09	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	NA	7.55E-06	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	NA	2.47E-11	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012367119	NA	9.59E-08	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251