\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005364262:

Variant ID: vg1005364262 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5364262
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTTCACCACATCCAATTCAAATTCGTTGTTAATAGCAAACTGTCTCATTGCCAATCTAAACTCCTCCATGCTGGGGTATGCAGTTCCAAGATCCATGC[A/G]
AGGGTTGTCAGGGTCATATGCCATCACATTTTCACCAGGAATTGAATCATCCACTGGAAGTGCAGCATCCATGTCATCTGGGCCTCCTACTCCAGCAACA

Reverse complement sequence

TGTTGCTGGAGTAGGAGGCCCAGATGACATGGATGCTGCACTTCCAGTGGATGATTCAATTCCTGGTGAAAATGTGATGGCATATGACCCTGACAACCCT[T/C]
GCATGGATCTTGGAACTGCATACCCCAGCATGGAGGAGTTTAGATTGGCAATGAGACAGTTTGCTATTAACAACGAATTTGAATTGGATGTGGTGAAGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 19.00% 4.89% 22.58% NA
All Indica  2759 55.50% 27.50% 5.00% 12.03% NA
All Japonica  1512 55.30% 2.00% 3.51% 39.22% NA
Aus  269 8.60% 34.90% 10.04% 46.47% NA
Indica I  595 54.30% 31.80% 3.87% 10.08% NA
Indica II  465 59.80% 12.70% 7.96% 19.57% NA
Indica III  913 51.20% 33.60% 3.18% 12.05% NA
Indica Intermediate  786 58.80% 26.00% 6.23% 9.03% NA
Temperate Japonica  767 69.40% 0.30% 4.04% 26.34% NA
Tropical Japonica  504 35.50% 4.60% 1.59% 58.33% NA
Japonica Intermediate  241 51.90% 2.10% 5.81% 40.25% NA
VI/Aromatic  96 87.50% 1.00% 6.25% 5.21% NA
Intermediate  90 65.60% 13.30% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005364262 A -> G LOC_Os10g09900.1 missense_variant ; p.Cys209Arg; MODERATE nonsynonymous_codon ; C209R Average:20.195; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 probably damaging 2.2 TOLERATED 0.08
vg1005364262 A -> DEL LOC_Os10g09900.1 N frameshift_variant Average:20.195; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005364262 9.47E-07 2.06E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 5.03E-06 NA mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 6.29E-10 NA mr1109 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 8.74E-12 2.70E-13 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.40E-08 NA mr1129 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 7.22E-10 2.48E-12 mr1129 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 6.12E-06 7.33E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 NA 1.68E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 7.91E-06 1.70E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 3.82E-06 1.31E-06 mr1243 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 9.68E-06 9.68E-06 mr1248 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.48E-07 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.77E-08 1.06E-12 mr1251 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.91E-06 NA mr1253 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.74E-07 1.47E-07 mr1253 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 3.99E-11 NA mr1255 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 6.30E-11 1.98E-13 mr1255 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.02E-10 NA mr1257 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.19E-10 8.43E-15 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.69E-06 1.69E-06 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 7.21E-08 NA mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.02E-10 3.79E-13 mr1423 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 5.26E-09 NA mr1435 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 3.28E-10 4.08E-14 mr1435 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 NA 5.51E-08 mr1559 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 4.26E-08 NA mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 3.77E-09 3.85E-11 mr1599 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 NA 4.27E-06 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 4.91E-06 NA mr1089_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 9.10E-08 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.27E-09 1.69E-10 mr1109_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.93E-06 NA mr1129_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 8.35E-08 1.91E-11 mr1129_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 NA 5.56E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 NA 5.93E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.33E-06 8.31E-09 mr1251_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 5.63E-07 NA mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 2.06E-06 7.54E-11 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.90E-06 NA mr1257_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 7.23E-07 6.69E-11 mr1257_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 5.78E-06 5.36E-08 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 8.66E-06 5.15E-07 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.96E-06 6.93E-09 mr1435_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 7.85E-06 1.11E-08 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 1.11E-06 3.50E-08 mr1599_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262 3.45E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251