Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005364262:

Variant ID: vg1005364262 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5364262
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTTCACCACATCCAATTCAAATTCGTTGTTAATAGCAAACTGTCTCATTGCCAATCTAAACTCCTCCATGCTGGGGTATGCAGTTCCAAGATCCATGC[A/G]
AGGGTTGTCAGGGTCATATGCCATCACATTTTCACCAGGAATTGAATCATCCACTGGAAGTGCAGCATCCATGTCATCTGGGCCTCCTACTCCAGCAACA

Reverse complement sequence

TGTTGCTGGAGTAGGAGGCCCAGATGACATGGATGCTGCACTTCCAGTGGATGATTCAATTCCTGGTGAAAATGTGATGGCATATGACCCTGACAACCCT[T/C]
GCATGGATCTTGGAACTGCATACCCCAGCATGGAGGAGTTTAGATTGGCAATGAGACAGTTTGCTATTAACAACGAATTTGAATTGGATGTGGTGAAGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	19.00%	4.89%	22.58%	NA
All Indica	2759	55.50%	27.50%	5.00%	12.03%	NA
All Japonica	1512	55.30%	2.00%	3.51%	39.22%	NA
Aus	269	8.60%	34.90%	10.04%	46.47%	NA
Indica I	595	54.30%	31.80%	3.87%	10.08%	NA
Indica II	465	59.80%	12.70%	7.96%	19.57%	NA
Indica III	913	51.20%	33.60%	3.18%	12.05%	NA
Indica Intermediate	786	58.80%	26.00%	6.23%	9.03%	NA
Temperate Japonica	767	69.40%	0.30%	4.04%	26.34%	NA
Tropical Japonica	504	35.50%	4.60%	1.59%	58.33%	NA
Japonica Intermediate	241	51.90%	2.10%	5.81%	40.25%	NA
VI/Aromatic	96	87.50%	1.00%	6.25%	5.21%	NA
Intermediate	90	65.60%	13.30%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005364262	A -> G	LOC_Os10g09900.1	missense_variant ; p.Cys209Arg; MODERATE	nonsynonymous_codon ; C209R	Average:20.195; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	probably damaging	2.2	TOLERATED	0.08
vg1005364262	A -> DEL	LOC_Os10g09900.1	N	frameshift_variant	Average:20.195; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005364262	9.47E-07	2.06E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	5.03E-06	NA	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	6.29E-10	NA	mr1109	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	8.74E-12	2.70E-13	mr1109	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.40E-08	NA	mr1129	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	7.22E-10	2.48E-12	mr1129	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	6.12E-06	7.33E-07	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	NA	1.68E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	7.91E-06	1.70E-08	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	3.82E-06	1.31E-06	mr1243	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	9.68E-06	9.68E-06	mr1248	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.48E-07	NA	mr1251	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.77E-08	1.06E-12	mr1251	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.91E-06	NA	mr1253	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.74E-07	1.47E-07	mr1253	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	3.99E-11	NA	mr1255	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	6.30E-11	1.98E-13	mr1255	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.02E-10	NA	mr1257	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.19E-10	8.43E-15	mr1257	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.69E-06	1.69E-06	mr1379	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	7.21E-08	NA	mr1423	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.02E-10	3.79E-13	mr1423	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	5.26E-09	NA	mr1435	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	3.28E-10	4.08E-14	mr1435	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	NA	5.51E-08	mr1559	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	4.26E-08	NA	mr1599	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	3.77E-09	3.85E-11	mr1599	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	NA	4.27E-06	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	4.91E-06	NA	mr1089_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	9.10E-08	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.27E-09	1.69E-10	mr1109_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.93E-06	NA	mr1129_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	8.35E-08	1.91E-11	mr1129_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	NA	5.56E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	NA	5.93E-09	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.33E-06	8.31E-09	mr1251_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	5.63E-07	NA	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	2.06E-06	7.54E-11	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.90E-06	NA	mr1257_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	7.23E-07	6.69E-11	mr1257_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	5.78E-06	5.36E-08	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	8.66E-06	5.15E-07	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.96E-06	6.93E-09	mr1435_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	7.85E-06	1.11E-08	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	1.11E-06	3.50E-08	mr1599_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364262	3.45E-06	NA	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251