Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002918909:

Variant ID: vg1002918909 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2918909
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGATTGCTCCCACCTTTTAAGTCATACTCCCCATCATCAATTACCGATCACTGGTGGAGAAACCATCTTTGGTCGGTCGGCCGAAATCCACAATAGTC[T/C]
CGGTTCCACTAAAAACCGGTTCAAAAGATGATCTTTAGTCCCGGTTCAAAAGGTTAGAGCTACTTTTTGATCTTTAGTCCCGGTTGGTAACATCAACCGG

Reverse complement sequence

CCGGTTGATGTTACCAACCGGGACTAAAGATCAAAAAGTAGCTCTAACCTTTTGAACCGGGACTAAAGATCATCTTTTGAACCGGTTTTTAGTGGAACCG[A/G]
GACTATTGTGGATTTCGGCCGACCGACCAAAGATGGTTTCTCCACCAGTGATCGGTAATTGATGATGGGGAGTATGACTTAAAAGGTGGGAGCAATCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 21.10% 1.33% 21.58% NA
All Indica  2759 89.50% 1.80% 1.27% 7.47% NA
All Japonica  1512 2.10% 57.40% 0.53% 40.01% NA
Aus  269 12.60% 16.00% 6.32% 65.06% NA
Indica I  595 97.80% 0.30% 0.17% 1.68% NA
Indica II  465 70.10% 2.80% 1.94% 25.16% NA
Indica III  913 95.70% 0.90% 0.66% 2.74% NA
Indica Intermediate  786 87.40% 3.30% 2.42% 6.87% NA
Temperate Japonica  767 0.70% 88.10% 0.39% 10.82% NA
Tropical Japonica  504 4.00% 9.10% 0.99% 85.91% NA
Japonica Intermediate  241 2.50% 60.60% 0.00% 36.93% NA
VI/Aromatic  96 77.10% 9.40% 0.00% 13.54% NA
Intermediate  90 43.30% 30.00% 3.33% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002918909 T -> C LOC_Os10g05780.1 upstream_gene_variant ; 4196.0bp to feature; MODIFIER silent_mutation Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg1002918909 T -> C LOC_Os10g05790.1 downstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg1002918909 T -> C LOC_Os10g05780-LOC_Os10g05790 intergenic_region ; MODIFIER silent_mutation Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg1002918909 T -> DEL N N silent_mutation Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002918909 NA 1.12E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 3.62E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 4.05E-09 mr1715 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 1.91E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 1.57E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 9.80E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 7.37E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 1.07E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 1.58E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 9.63E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 6.45E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 2.77E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002918909 NA 2.48E-07 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251