\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002756136:

Variant ID: vg1002756136 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2756136
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGTTTGGGGTACGGTCAGCTCACCGGGAGGATCGCCCTCCCAATTCGAAGTTTTTTCCAAGAAGTTTCAACCGTCGTTGACTATGACAATAGTCGCGA[C/T]
CGACTATTAAGATCCTCGTGACTATGGAAGGGCGGTACGCTCTGCTCTCTCGCGACCTCTAGTCTAATCAAAAGACTAAAGGCCCCTACGGAAGATGAAA

Reverse complement sequence

TTTCATCTTCCGTAGGGGCCTTTAGTCTTTTGATTAGACTAGAGGTCGCGAGAGAGCAGAGCGTACCGCCCTTCCATAGTCACGAGGATCTTAATAGTCG[G/A]
TCGCGACTATTGTCATAGTCAACGACGGTTGAAACTTCTTGGAAAAAACTTCGAATTGGGAGGGCGATCCTCCCGGTGAGCTGACCGTACCCCAAACCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 5.90% 1.61% 3.41% NA
All Indica  2759 96.90% 0.30% 0.72% 2.14% NA
All Japonica  1512 79.40% 17.80% 2.71% 0.07% NA
Aus  269 84.80% 0.00% 4.09% 11.15% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 99.10% 0.00% 0.00% 0.86% NA
Indica III  913 93.50% 0.20% 1.31% 4.93% NA
Indica Intermediate  786 97.50% 0.60% 0.64% 1.27% NA
Temperate Japonica  767 95.60% 3.30% 1.17% 0.00% NA
Tropical Japonica  504 51.00% 44.00% 4.96% 0.00% NA
Japonica Intermediate  241 87.60% 9.10% 2.90% 0.41% NA
VI/Aromatic  96 32.30% 0.00% 1.04% 66.67% NA
Intermediate  90 83.30% 5.60% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002756136 C -> T LOC_Os10g05550.1 downstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 N N N N
vg1002756136 C -> T LOC_Os10g05560.1 downstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 N N N N
vg1002756136 C -> T LOC_Os10g05550-LOC_Os10g05560 intergenic_region ; MODIFIER silent_mutation Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 N N N N
vg1002756136 C -> DEL N N silent_mutation Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002756136 NA 2.27E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 3.14E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 8.03E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 3.70E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 4.61E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 4.22E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.93E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.72E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 8.99E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.80E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.75E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 5.78E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.97E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 6.23E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 6.56E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 4.85E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.62E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.60E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.07E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 4.57E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 3.78E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.97E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.15E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 2.58E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 4.67E-06 2.25E-12 mr1696_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.38E-10 mr1696_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 6.49E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.26E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 3.37E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 6.59E-13 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 7.50E-09 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.17E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002756136 NA 1.90E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251