\
| Variant ID: vg1002756136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2756136 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGGTTTGGGGTACGGTCAGCTCACCGGGAGGATCGCCCTCCCAATTCGAAGTTTTTTCCAAGAAGTTTCAACCGTCGTTGACTATGACAATAGTCGCGA[C/T]
CGACTATTAAGATCCTCGTGACTATGGAAGGGCGGTACGCTCTGCTCTCTCGCGACCTCTAGTCTAATCAAAAGACTAAAGGCCCCTACGGAAGATGAAA
TTTCATCTTCCGTAGGGGCCTTTAGTCTTTTGATTAGACTAGAGGTCGCGAGAGAGCAGAGCGTACCGCCCTTCCATAGTCACGAGGATCTTAATAGTCG[G/A]
TCGCGACTATTGTCATAGTCAACGACGGTTGAAACTTCTTGGAAAAAACTTCGAATTGGGAGGGCGATCCTCCCGGTGAGCTGACCGTACCCCAAACCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 5.90% | 1.61% | 3.41% | NA |
| All Indica | 2759 | 96.90% | 0.30% | 0.72% | 2.14% | NA |
| All Japonica | 1512 | 79.40% | 17.80% | 2.71% | 0.07% | NA |
| Aus | 269 | 84.80% | 0.00% | 4.09% | 11.15% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.00% | 0.86% | NA |
| Indica III | 913 | 93.50% | 0.20% | 1.31% | 4.93% | NA |
| Indica Intermediate | 786 | 97.50% | 0.60% | 0.64% | 1.27% | NA |
| Temperate Japonica | 767 | 95.60% | 3.30% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 51.00% | 44.00% | 4.96% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 9.10% | 2.90% | 0.41% | NA |
| VI/Aromatic | 96 | 32.30% | 0.00% | 1.04% | 66.67% | NA |
| Intermediate | 90 | 83.30% | 5.60% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002756136 | C -> T | LOC_Os10g05550.1 | downstream_gene_variant ; 2997.0bp to feature; MODIFIER | silent_mutation | Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 | N | N | N | N |
| vg1002756136 | C -> T | LOC_Os10g05560.1 | downstream_gene_variant ; 4477.0bp to feature; MODIFIER | silent_mutation | Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 | N | N | N | N |
| vg1002756136 | C -> T | LOC_Os10g05550-LOC_Os10g05560 | intergenic_region ; MODIFIER | silent_mutation | Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 | N | N | N | N |
| vg1002756136 | C -> DEL | N | N | silent_mutation | Average:79.405; most accessible tissue: Minghui63 flag leaf, score: 96.33 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002756136 | NA | 2.27E-09 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 3.14E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 8.03E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 3.70E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 4.61E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 4.22E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.93E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.72E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | 8.99E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.80E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.75E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 5.78E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.97E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 6.23E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 6.56E-10 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 4.85E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.62E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.60E-08 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.07E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 4.57E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 3.78E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.97E-08 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.15E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 2.58E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | 4.67E-06 | 2.25E-12 | mr1696_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.38E-10 | mr1696_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 6.49E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.26E-07 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 3.37E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 6.59E-13 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 7.50E-09 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.17E-11 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002756136 | NA | 1.90E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |