Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001052700:

Variant ID: vg1001052700 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1052700
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATTTTGATAATTATTCGTTACCGTATTCGTTTCGATTCGTATTCGGCTCCGTATCTGTATTCGATAATATTCGATTCCGTTTTCGTATCCGGGTTTC[C/T]
GATTCCGATTTCGATTCCGAGAAAAAAATATGAAAACGAATATGATATAGCTAGTTTCCGACCGTATTCGATCCGTTTTCATCCCTATCTTGCACTCGTC

Reverse complement sequence

GACGAGTGCAAGATAGGGATGAAAACGGATCGAATACGGTCGGAAACTAGCTATATCATATTCGTTTTCATATTTTTTTCTCGGAATCGAAATCGGAATC[G/A]
GAAACCCGGATACGAAAACGGAATCGAATATTATCGAATACAGATACGGAGCCGAATACGAATCGAAACGAATACGGTAACGAATAATTATCAAAATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.50% 0.90% 21.12% 54.53% NA
All Indica  2759 11.50% 0.30% 21.24% 67.02% NA
All Japonica  1512 47.50% 2.30% 17.13% 33.07% NA
Aus  269 9.30% 0.00% 47.21% 43.49% NA
Indica I  595 11.40% 0.00% 10.76% 77.82% NA
Indica II  465 14.80% 0.40% 35.48% 49.25% NA
Indica III  913 9.40% 0.10% 21.69% 68.78% NA
Indica Intermediate  786 12.00% 0.50% 20.23% 67.30% NA
Temperate Japonica  767 66.90% 1.70% 6.13% 25.29% NA
Tropical Japonica  504 29.40% 2.20% 29.56% 38.89% NA
Japonica Intermediate  241 23.70% 4.60% 26.14% 45.64% NA
VI/Aromatic  96 10.40% 0.00% 12.50% 77.08% NA
Intermediate  90 43.30% 0.00% 15.56% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001052700 C -> T LOC_Os10g02670.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N
vg1001052700 C -> T LOC_Os10g02680.1 upstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N
vg1001052700 C -> T LOC_Os10g02700.1 upstream_gene_variant ; 4768.0bp to feature; MODIFIER silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N
vg1001052700 C -> T LOC_Os10g02690.1 downstream_gene_variant ; 2129.0bp to feature; MODIFIER silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N
vg1001052700 C -> T LOC_Os10g02670-LOC_Os10g02680 intergenic_region ; MODIFIER silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N
vg1001052700 C -> DEL N N silent_mutation Average:19.254; most accessible tissue: Callus, score: 45.704 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001052700 NA 1.22E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700 1.80E-08 2.43E-09 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700 NA 6.12E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700 NA 1.88E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700 NA 2.12E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700 NA 4.25E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251