Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921500312:

Variant ID: vg0921500312 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21500312
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATCAAGATGATTGGATTCAAGCTAGAGATAGCACCACTCCAAGGCATATGAATCAAGATGCCATTGAAGAAACAGAGATGGCTGATTCTGAACCATC[C/T]
AAAGCACGAACATTAGATTCTCAACAAGCTTTTCCACAAAAGCAACCACCAGCTGAAGATCTACGATTTGCTGCTTCAACATCCAATAGAAGATATTTTG

Reverse complement sequence

CAAAATATCTTCTATTGGATGTTGAAGCAGCAAATCGTAGATCTTCAGCTGGTGGTTGCTTTTGTGGAAAAGCTTGTTGAGAATCTAATGTTCGTGCTTT[G/A]
GATGGTTCAGAATCAGCCATCTCTGTTTCTTCAATGGCATCTTGATTCATATGCCTTGGAGTGGTGCTATCTCTAGCTTGAATCCAATCATCTTGATCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.40% 0.11% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 92.50% 7.20% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 1.80% 0.13% 0.00% NA
Tropical Japonica  504 82.70% 16.50% 0.79% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921500312 C -> T LOC_Os09g37240.1 synonymous_variant ; p.Ser762Ser; LOW synonymous_codon Average:46.516; most accessible tissue: Callus, score: 80.895 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921500312 NA 1.80E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 5.17E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 7.72E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 9.63E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 3.38E-06 3.52E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 4.61E-06 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 1.48E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 6.06E-06 4.84E-08 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 5.74E-06 3.23E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 4.46E-06 4.46E-06 mr1345_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 7.88E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 1.04E-06 1.04E-06 mr1384_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 5.34E-09 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 8.89E-06 8.89E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 3.29E-06 1.49E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 1.24E-06 1.24E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 2.22E-07 2.22E-07 mr1511_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 4.80E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 6.62E-06 6.62E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 2.28E-06 6.02E-09 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 1.55E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 1.73E-07 1.73E-07 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 6.49E-07 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 5.09E-07 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 3.97E-06 9.40E-09 mr1606_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 1.07E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 8.48E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 5.47E-06 7.13E-08 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 6.81E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 9.16E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 4.97E-06 1.50E-09 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 2.80E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 4.22E-06 4.22E-06 mr1934_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 NA 2.21E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921500312 3.06E-06 4.24E-08 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251