\
| Variant ID: vg0918924003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 18924003 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 241. )
GTTGGAATAAGTAGCTTTTAGTGGCAAACTATCTGTTGGGAAAGATAAAGTGGCATAGTATAATTTTTTTCTACCGACAGACAATTGTCTTCTTTTTAGT[G/A]
TTGTAGTGTAGTGTGTGTGCGCGCGCATAAAACATACACATATAGTTCTAGCTCATGCATATGTATCTTTTGTTTGATGCATATGTTGGGTTCAATTCCA
TGGAATTGAACCCAACATATGCATCAAACAAAAGATACATATGCATGAGCTAGAACTATATGTGTATGTTTTATGCGCGCGCACACACACTACACTACAA[C/T]
ACTAAAAAGAAGACAATTGTCTGTCGGTAGAAAAAAATTATACTATGCCACTTTATCTTTCCCAACAGATAGTTTGCCACTAAAAGCTACTTATTCCAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 38.50% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 34.20% | 65.30% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 16.80% | 83.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 71.60% | 27.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 20.50% | 78.90% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 41.20% | 58.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918924003 | G -> A | LOC_Os09g31438.1 | upstream_gene_variant ; 2347.0bp to feature; MODIFIER | silent_mutation | Average:54.633; most accessible tissue: Callus, score: 80.742 | N | N | N | N |
| vg0918924003 | G -> A | LOC_Os09g31438-LOC_Os09g31442 | intergenic_region ; MODIFIER | silent_mutation | Average:54.633; most accessible tissue: Callus, score: 80.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918924003 | 9.58E-06 | NA | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 2.52E-09 | 1.06E-14 | mr1231 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 3.81E-09 | 3.73E-13 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 8.80E-11 | NA | mr1232 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 1.14E-10 | 2.04E-11 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 8.59E-23 | NA | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 1.06E-22 | 3.95E-33 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 9.34E-21 | 1.67E-46 | mr1598 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 7.46E-16 | 4.08E-23 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 3.45E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 6.55E-10 | NA | mr1944 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 3.00E-10 | 5.04E-14 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 3.97E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 5.75E-08 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 8.67E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 2.39E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 3.21E-19 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | NA | 3.62E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 2.30E-15 | NA | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 6.89E-15 | 6.23E-25 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 1.60E-18 | 3.60E-67 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918924003 | 3.11E-15 | 7.52E-29 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |