\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901387691:

Variant ID: vg0901387691 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1387691
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTCGTCATCAAAGGGGCATAGGTTCGTGCTAGTTGCTATGGATTACTTCACCAAGTGGGCCGAAGCCGTGCCTTTGAAGAATATGACTCATACGGAGG[A/T]
AATTGACTTTATTTTGAAGCATATTATCCATAGATTCGGTATTCCACAAACATTAACTACGGACCAAGGTACTTCTTTTATGTCTAAGGAAGTGAAGAGT

Reverse complement sequence

ACTCTTCACTTCCTTAGACATAAAAGAAGTACCTTGGTCCGTAGTTAATGTTTGTGGAATACCGAATCTATGGATAATATGCTTCAAAATAAAGTCAATT[T/A]
CCTCCGTATGAGTCATATTCTTCAAAGGCACGGCTTCGGCCCACTTGGTGAAGTAATCCATAGCAACTAGCACGAACCTATGCCCCTTTGATGACGAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 24.20% 2.41% 10.83% NA
All Indica  2759 94.30% 3.20% 1.74% 0.80% NA
All Japonica  1512 1.80% 67.70% 3.24% 27.25% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 92.90% 6.40% 0.17% 0.50% NA
Indica II  465 97.60% 1.90% 0.22% 0.22% NA
Indica III  913 96.50% 0.40% 2.41% 0.66% NA
Indica Intermediate  786 90.70% 4.70% 3.05% 1.53% NA
Temperate Japonica  767 0.80% 97.80% 0.00% 1.43% NA
Tropical Japonica  504 2.80% 27.40% 8.73% 61.11% NA
Japonica Intermediate  241 2.90% 56.40% 2.07% 38.59% NA
VI/Aromatic  96 12.50% 9.40% 10.42% 67.71% NA
Intermediate  90 52.20% 26.70% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901387691 A -> DEL N N silent_mutation Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0901387691 A -> T LOC_Os09g02960.1 downstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0901387691 A -> T LOC_Os09g02950.1 intron_variant ; MODIFIER silent_mutation Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901387691 NA 1.69E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901387691 4.69E-06 NA Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901387691 6.08E-08 9.19E-17 Grain_width Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901387691 NA 2.24E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 2.62E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 3.54E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 1.36E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 2.70E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 1.19E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 1.32E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 2.44E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901387691 NA 6.56E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251