\
| Variant ID: vg0901387691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1387691 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 94. )
CCTTCGTCATCAAAGGGGCATAGGTTCGTGCTAGTTGCTATGGATTACTTCACCAAGTGGGCCGAAGCCGTGCCTTTGAAGAATATGACTCATACGGAGG[A/T]
AATTGACTTTATTTTGAAGCATATTATCCATAGATTCGGTATTCCACAAACATTAACTACGGACCAAGGTACTTCTTTTATGTCTAAGGAAGTGAAGAGT
ACTCTTCACTTCCTTAGACATAAAAGAAGTACCTTGGTCCGTAGTTAATGTTTGTGGAATACCGAATCTATGGATAATATGCTTCAAAATAAAGTCAATT[T/A]
CCTCCGTATGAGTCATATTCTTCAAAGGCACGGCTTCGGCCCACTTGGTGAAGTAATCCATAGCAACTAGCACGAACCTATGCCCCTTTGATGACGAAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 24.20% | 2.41% | 10.83% | NA |
| All Indica | 2759 | 94.30% | 3.20% | 1.74% | 0.80% | NA |
| All Japonica | 1512 | 1.80% | 67.70% | 3.24% | 27.25% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 92.90% | 6.40% | 0.17% | 0.50% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.22% | 0.22% | NA |
| Indica III | 913 | 96.50% | 0.40% | 2.41% | 0.66% | NA |
| Indica Intermediate | 786 | 90.70% | 4.70% | 3.05% | 1.53% | NA |
| Temperate Japonica | 767 | 0.80% | 97.80% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 2.80% | 27.40% | 8.73% | 61.11% | NA |
| Japonica Intermediate | 241 | 2.90% | 56.40% | 2.07% | 38.59% | NA |
| VI/Aromatic | 96 | 12.50% | 9.40% | 10.42% | 67.71% | NA |
| Intermediate | 90 | 52.20% | 26.70% | 7.78% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901387691 | A -> DEL | N | N | silent_mutation | Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0901387691 | A -> T | LOC_Os09g02960.1 | downstream_gene_variant ; 3296.0bp to feature; MODIFIER | silent_mutation | Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0901387691 | A -> T | LOC_Os09g02950.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.887; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901387691 | NA | 1.69E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901387691 | 4.69E-06 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901387691 | 6.08E-08 | 9.19E-17 | Grain_width | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901387691 | NA | 2.24E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 2.62E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 3.54E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 1.36E-06 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 2.70E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 1.19E-07 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 1.32E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 2.44E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901387691 | NA | 6.56E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |