\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820694826:

Variant ID: vg0820694826 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20694826
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGCCTTCTCGGCGAGGTCAACCAGGTTTCGGCACGGTTGATAACCAGAGGAGACGTGGTGCTGCGATTGCGAGGCTCAGTAGCGTGTTCGTTCAGAAG[T/C]
CGGATCGAGTTATGTCACCACTCCGTCCAAATCGACTGTTTATCAATACCTATCGGAAAATCGGGACCTACCTCCCTCGTCACTATCCCTACGGTTTTTC

Reverse complement sequence

GAAAAACCGTAGGGATAGTGACGAGGGAGGTAGGTCCCGATTTTCCGATAGGTATTGATAAACAGTCGATTTGGACGGAGTGGTGACATAACTCGATCCG[A/G]
CTTCTGAACGAACACGCTACTGAGCCTCGCAATCGCAGCACCACGTCTCCTCTGGTTATCAACCGTGCCGAAACCTGGTTGACCTCGCCGAGAAGGCTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.30% 0.11% 0.40% NA
All Indica  2759 88.80% 10.70% 0.04% 0.54% NA
All Japonica  1512 1.90% 98.00% 0.07% 0.07% NA
Aus  269 70.30% 29.70% 0.00% 0.00% NA
Indica I  595 97.00% 2.50% 0.00% 0.50% NA
Indica II  465 95.90% 3.70% 0.00% 0.43% NA
Indica III  913 83.00% 16.50% 0.11% 0.33% NA
Indica Intermediate  786 85.00% 14.10% 0.00% 0.89% NA
Temperate Japonica  767 2.00% 97.90% 0.00% 0.13% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 34.40% 58.90% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820694826 T -> C LOC_Os08g33210.1 downstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:63.758; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0820694826 T -> C LOC_Os08g33200-LOC_Os08g33210 intergenic_region ; MODIFIER silent_mutation Average:63.758; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0820694826 T -> DEL N N silent_mutation Average:63.758; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820694826 NA 8.28E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 3.57E-07 1.78E-07 mr1157 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 8.35E-06 8.35E-06 mr1187 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 8.51E-06 2.09E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 4.08E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 4.95E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 3.96E-07 1.06E-07 mr1328 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 3.65E-06 9.80E-06 mr1371 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 7.70E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 2.12E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 2.12E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 1.61E-07 3.80E-08 mr1446 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 7.61E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 4.36E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 2.58E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 2.98E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 2.65E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 1.00E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 8.65E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 6.61E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820694826 NA 1.02E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251