\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820038770:

Variant ID: vg0820038770 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20038770
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTTCATATAAAACGAACAATCAAACGTACACAGGAACCACGGTTTGCATTGACGGAGGGAGTACACGGGTACACGGGCACGATCCGTACGGCCGCG[T/C]
CTCCTCGCCTTCCTCTCACGCTCGCACCCACCCACCCACCCACCCTTCTCACTTTGCTCAGCTCCACTCCACTCCACGCCTCCACCCACCCACTCCGCCG

Reverse complement sequence

CGGCGGAGTGGGTGGGTGGAGGCGTGGAGTGGAGTGGAGCTGAGCAAAGTGAGAAGGGTGGGTGGGTGGGTGGGTGCGAGCGTGAGAGGAAGGCGAGGAG[A/G]
CGCGGCCGTACGGATCGTGCCCGTGTACCCGTGTACTCCCTCCGTCAATGCAAACCGTGGTTCCTGTGTACGTTTGATTGTTCGTTTTATATGAAATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 9.60% 9.04% 10.85% NA
All Indica  2759 85.00% 0.20% 3.08% 11.67% NA
All Japonica  1512 57.20% 28.20% 12.04% 2.51% NA
Aus  269 16.00% 0.70% 48.33% 34.94% NA
Indica I  595 97.60% 0.20% 1.18% 1.01% NA
Indica II  465 86.20% 0.00% 1.72% 12.04% NA
Indica III  913 81.40% 0.00% 3.29% 15.33% NA
Indica Intermediate  786 79.00% 0.60% 5.09% 15.27% NA
Temperate Japonica  767 39.40% 38.70% 18.90% 3.00% NA
Tropical Japonica  504 89.90% 6.20% 2.78% 1.19% NA
Japonica Intermediate  241 45.60% 41.10% 9.54% 3.73% NA
VI/Aromatic  96 30.20% 6.20% 16.67% 46.88% NA
Intermediate  90 54.40% 14.40% 15.56% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820038770 T -> C LOC_Os08g32360.1 upstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:82.809; most accessible tissue: Zhenshan97 panicle, score: 97.834 N N N N
vg0820038770 T -> C LOC_Os08g32350.2 downstream_gene_variant ; 3060.0bp to feature; MODIFIER silent_mutation Average:82.809; most accessible tissue: Zhenshan97 panicle, score: 97.834 N N N N
vg0820038770 T -> C LOC_Os08g32350-LOC_Os08g32360 intergenic_region ; MODIFIER silent_mutation Average:82.809; most accessible tissue: Zhenshan97 panicle, score: 97.834 N N N N
vg0820038770 T -> DEL N N silent_mutation Average:82.809; most accessible tissue: Zhenshan97 panicle, score: 97.834 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820038770 T C -0.1 -0.15 -0.11 -0.07 -0.1 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820038770 NA 1.58E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.23E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 1.57E-06 1.57E-06 mr1207_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 7.00E-06 1.69E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 7.81E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 4.37E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 1.95E-06 4.29E-14 mr1228_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.82E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 2.89E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 4.22E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 2.40E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.35E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 5.48E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.68E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 9.84E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 1.86E-06 NA mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 7.25E-06 4.19E-11 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 5.78E-06 5.77E-06 mr1569_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 5.97E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 2.13E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.60E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 1.12E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 3.15E-06 1.74E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 5.75E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 2.27E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 4.93E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 2.09E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 4.50E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 6.57E-06 1.10E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 7.45E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 3.17E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 9.77E-06 NA mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 8.13E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820038770 NA 4.09E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251