Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812030091:

Variant ID: vg0812030091 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12030091
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGGTTTTTTATATCATGTCTTGGCTAGGATTCGAACCCAAGACCTATCCTTCACGCGTGCTCTCCTTTACCAACTCACCTACACATCAATTCTATTG[A/G,T]
AAAATGCATATCGTTCCATTTGAGCCTATCTAATTGAGATTTGAATCATAGATATGAATATCTAAAAGGTTTCAAATGAAAAGGTTATCACCTATAAAAT

Reverse complement sequence

ATTTTATAGGTGATAACCTTTTCATTTGAAACCTTTTAGATATTCATATCTATGATTCAAATCTCAATTAGATAGGCTCAAATGGAACGATATGCATTTT[T/C,A]
CAATAGAATTGATGTGTAGGTGAGTTGGTAAAGGAGAGCACGCGTGAAGGATAGGTCTTGGGTTCGAATCCTAGCCAAGACATGATATAAAAAACCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	23.30%	14.41%	3.81%	T: 0.02%
All Indica	2759	88.30%	5.70%	5.11%	0.94%	NA
All Japonica	1512	7.90%	57.90%	25.46%	8.73%	NA
Aus	269	59.90%	1.10%	33.09%	5.58%	T: 0.37%
Indica I	595	92.30%	4.20%	2.69%	0.84%	NA
Indica II	465	88.80%	4.10%	4.73%	2.37%	NA
Indica III	913	87.50%	7.10%	5.26%	0.11%	NA
Indica Intermediate	786	85.80%	6.10%	7.00%	1.15%	NA
Temperate Japonica	767	2.20%	85.30%	9.78%	2.74%	NA
Tropical Japonica	504	13.70%	27.80%	43.25%	15.28%	NA
Japonica Intermediate	241	13.70%	34.00%	38.17%	14.11%	NA
VI/Aromatic	96	14.60%	39.60%	42.71%	3.12%	NA
Intermediate	90	38.90%	28.90%	27.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812030091	A -> G	LOC_Os08g20070.1	downstream_gene_variant ; 3604.0bp to feature; MODIFIER	silent_mutation	Average:10.303; most accessible tissue: Callus, score: 21.899	N	N	N	N
vg0812030091	A -> G	LOC_Os08g20060.1	intron_variant ; MODIFIER	silent_mutation	Average:10.303; most accessible tissue: Callus, score: 21.899	N	N	N	N
vg0812030091	A -> T	LOC_Os08g20070.1	downstream_gene_variant ; 3604.0bp to feature; MODIFIER	silent_mutation	Average:10.303; most accessible tissue: Callus, score: 21.899	N	N	N	N
vg0812030091	A -> T	LOC_Os08g20060.1	intron_variant ; MODIFIER	silent_mutation	Average:10.303; most accessible tissue: Callus, score: 21.899	N	N	N	N
vg0812030091	A -> DEL	N	N	silent_mutation	Average:10.303; most accessible tissue: Callus, score: 21.899	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812030091	NA	1.30E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812030091	NA	6.45E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	4.40E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	8.38E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	3.06E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	1.88E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	2.85E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	7.18E-09	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	1.77E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	2.78E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	3.96E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	4.73E-06	mr1740	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	1.55E-07	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	5.19E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	2.17E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091	NA	1.13E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251