\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812030091:

Variant ID: vg0812030091 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12030091
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGGTTTTTTATATCATGTCTTGGCTAGGATTCGAACCCAAGACCTATCCTTCACGCGTGCTCTCCTTTACCAACTCACCTACACATCAATTCTATTG[A/G,T]
AAAATGCATATCGTTCCATTTGAGCCTATCTAATTGAGATTTGAATCATAGATATGAATATCTAAAAGGTTTCAAATGAAAAGGTTATCACCTATAAAAT

Reverse complement sequence

ATTTTATAGGTGATAACCTTTTCATTTGAAACCTTTTAGATATTCATATCTATGATTCAAATCTCAATTAGATAGGCTCAAATGGAACGATATGCATTTT[T/C,A]
CAATAGAATTGATGTGTAGGTGAGTTGGTAAAGGAGAGCACGCGTGAAGGATAGGTCTTGGGTTCGAATCCTAGCCAAGACATGATATAAAAAACCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 23.30% 14.41% 3.81% T: 0.02%
All Indica  2759 88.30% 5.70% 5.11% 0.94% NA
All Japonica  1512 7.90% 57.90% 25.46% 8.73% NA
Aus  269 59.90% 1.10% 33.09% 5.58% T: 0.37%
Indica I  595 92.30% 4.20% 2.69% 0.84% NA
Indica II  465 88.80% 4.10% 4.73% 2.37% NA
Indica III  913 87.50% 7.10% 5.26% 0.11% NA
Indica Intermediate  786 85.80% 6.10% 7.00% 1.15% NA
Temperate Japonica  767 2.20% 85.30% 9.78% 2.74% NA
Tropical Japonica  504 13.70% 27.80% 43.25% 15.28% NA
Japonica Intermediate  241 13.70% 34.00% 38.17% 14.11% NA
VI/Aromatic  96 14.60% 39.60% 42.71% 3.12% NA
Intermediate  90 38.90% 28.90% 27.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812030091 A -> G LOC_Os08g20070.1 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:10.303; most accessible tissue: Callus, score: 21.899 N N N N
vg0812030091 A -> G LOC_Os08g20060.1 intron_variant ; MODIFIER silent_mutation Average:10.303; most accessible tissue: Callus, score: 21.899 N N N N
vg0812030091 A -> T LOC_Os08g20070.1 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:10.303; most accessible tissue: Callus, score: 21.899 N N N N
vg0812030091 A -> T LOC_Os08g20060.1 intron_variant ; MODIFIER silent_mutation Average:10.303; most accessible tissue: Callus, score: 21.899 N N N N
vg0812030091 A -> DEL N N silent_mutation Average:10.303; most accessible tissue: Callus, score: 21.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812030091 NA 1.30E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812030091 NA 6.45E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 4.40E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 8.38E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 3.06E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 1.88E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 2.85E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 7.18E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 1.77E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 2.78E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 3.96E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 4.73E-06 mr1740 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 1.55E-07 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 5.19E-10 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 2.17E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812030091 NA 1.13E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251