Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727914669:

Variant ID: vg0727914669 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27914669
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CCATAAGGTCCATGGCAAAAACACCACCCATCCATGTTGAGTCTATAACACATATGTCGTCAACATGGTTACATCATGTCTATCTCCGTATTTATAGAGA[T/C]
GACCCAGGTTATAAATCTTGATACTAGCGGTATTCATTTACCACGATTAACTCAAAAGTCATCTTGCAACTTATTCGACACATATTCCAACAATAATCTT

Reverse complement sequence

AAGATTATTGTTGGAATATGTGTCGAATAAGTTGCAAGATGACTTTTGAGTTAATCGTGGTAAATGAATACCGCTAGTATCAAGATTTATAACCTGGGTC[A/G]
TCTCTATAAATACGGAGATAGACATGATGTAACCATGTTGACGACATATGTGTTATAGACTCAACATGGATGGGTGGTGTTTTTGCCATGGACCTTATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	39.10%	0.17%	0.08%	NA
All Indica	2759	67.50%	32.00%	0.29%	0.14%	NA
All Japonica	1512	55.30%	44.70%	0.00%	0.00%	NA
Aus	269	21.60%	78.40%	0.00%	0.00%	NA
Indica I	595	49.60%	49.60%	0.67%	0.17%	NA
Indica II	465	73.10%	26.20%	0.43%	0.22%	NA
Indica III	913	76.60%	23.30%	0.00%	0.11%	NA
Indica Intermediate	786	67.30%	32.30%	0.25%	0.13%	NA
Temperate Japonica	767	91.80%	8.20%	0.00%	0.00%	NA
Tropical Japonica	504	12.10%	87.90%	0.00%	0.00%	NA
Japonica Intermediate	241	29.50%	70.50%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727914669	T -> DEL	N	N	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46690.1	upstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46700.1	downstream_gene_variant ; 652.0bp to feature; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46700.2	downstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46700.3	downstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46700.4	downstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0727914669	T -> C	LOC_Os07g46690-LOC_Os07g46700	intergenic_region ; MODIFIER	silent_mutation	Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727914669	NA	8.72E-08	mr1460	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669	NA	1.46E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669	5.93E-06	1.86E-07	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669	NA	6.31E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251