\
| Variant ID: vg0727691010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27691010 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTTTAAATTTTTTTTGCTCTTCGATTAAATCTTCATTGCCCAATCATTTTTCAAAGAAATCCAGTGATGGGATGCAATCTTCGAACTTACATTTTTTAG[C/G]
ACAGCAGATCAATATTGACAAGGCAGGAAGAAAGTGACTCAAATTTTGAGCTATCATTGTGTTGTTATATTTTGATAGTATCTGTCCAGCCAGATGGTTT
AAACCATCTGGCTGGACAGATACTATCAAAATATAACAACACAATGATAGCTCAAAATTTGAGTCACTTTCTTCCTGCCTTGTCAATATTGATCTGCTGT[G/C]
CTAAAAAATGTAAGTTCGAAGATTGCATCCCATCACTGGATTTCTTTGAAAAATGATTGGGCAATGAAGATTTAATCGAAGAGCAAAAAAAATTTAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 0.10% | 1.16% | 16.31% | NA |
| All Indica | 2759 | 93.80% | 0.00% | 0.36% | 5.84% | NA |
| All Japonica | 1512 | 59.70% | 0.30% | 2.71% | 37.30% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 82.00% | 0.00% | 0.67% | 17.31% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.22% | 0.86% | NA |
| Indica III | 913 | 98.50% | 0.00% | 0.22% | 1.31% | NA |
| Indica Intermediate | 786 | 94.30% | 0.00% | 0.38% | 5.34% | NA |
| Temperate Japonica | 767 | 78.40% | 0.40% | 4.04% | 17.21% | NA |
| Tropical Japonica | 504 | 40.50% | 0.20% | 0.99% | 58.33% | NA |
| Japonica Intermediate | 241 | 40.20% | 0.40% | 2.07% | 57.26% | NA |
| VI/Aromatic | 96 | 65.60% | 1.00% | 1.04% | 32.29% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727691010 | C -> DEL | N | N | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46400.1 | upstream_gene_variant ; 2118.0bp to feature; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46410.1 | upstream_gene_variant ; 3612.0bp to feature; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46390.1 | downstream_gene_variant ; 4483.0bp to feature; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46390.3 | downstream_gene_variant ; 4483.0bp to feature; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46390.2 | downstream_gene_variant ; 4483.0bp to feature; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0727691010 | C -> G | LOC_Os07g46400-LOC_Os07g46410 | intergenic_region ; MODIFIER | silent_mutation | Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727691010 | 4.13E-06 | 6.67E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727691010 | 1.23E-06 | 2.11E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727691010 | 2.73E-06 | 7.16E-07 | mr1515 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727691010 | 9.07E-06 | 1.80E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727691010 | 3.30E-07 | 1.12E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727691010 | NA | 7.96E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |