\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727691010:

Variant ID: vg0727691010 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27691010
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAAATTTTTTTTGCTCTTCGATTAAATCTTCATTGCCCAATCATTTTTCAAAGAAATCCAGTGATGGGATGCAATCTTCGAACTTACATTTTTTAG[C/G]
ACAGCAGATCAATATTGACAAGGCAGGAAGAAAGTGACTCAAATTTTGAGCTATCATTGTGTTGTTATATTTTGATAGTATCTGTCCAGCCAGATGGTTT

Reverse complement sequence

AAACCATCTGGCTGGACAGATACTATCAAAATATAACAACACAATGATAGCTCAAAATTTGAGTCACTTTCTTCCTGCCTTGTCAATATTGATCTGCTGT[G/C]
CTAAAAAATGTAAGTTCGAAGATTGCATCCCATCACTGGATTTCTTTGAAAAATGATTGGGCAATGAAGATTTAATCGAAGAGCAAAAAAAATTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 0.10% 1.16% 16.31% NA
All Indica  2759 93.80% 0.00% 0.36% 5.84% NA
All Japonica  1512 59.70% 0.30% 2.71% 37.30% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 82.00% 0.00% 0.67% 17.31% NA
Indica II  465 98.90% 0.00% 0.22% 0.86% NA
Indica III  913 98.50% 0.00% 0.22% 1.31% NA
Indica Intermediate  786 94.30% 0.00% 0.38% 5.34% NA
Temperate Japonica  767 78.40% 0.40% 4.04% 17.21% NA
Tropical Japonica  504 40.50% 0.20% 0.99% 58.33% NA
Japonica Intermediate  241 40.20% 0.40% 2.07% 57.26% NA
VI/Aromatic  96 65.60% 1.00% 1.04% 32.29% NA
Intermediate  90 82.20% 0.00% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727691010 C -> DEL N N silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46400.1 upstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46410.1 upstream_gene_variant ; 3612.0bp to feature; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46390.1 downstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46390.3 downstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46390.2 downstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0727691010 C -> G LOC_Os07g46400-LOC_Os07g46410 intergenic_region ; MODIFIER silent_mutation Average:21.77; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727691010 4.13E-06 6.67E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010 1.23E-06 2.11E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010 2.73E-06 7.16E-07 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010 9.07E-06 1.80E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010 3.30E-07 1.12E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010 NA 7.96E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251