Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725681375:

Variant ID: vg0725681375 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25681375
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGTACATAAACATGTTAGAGAGATCAAATGGGTACATCAGCTCATCTAGTTCTGTAAGATGAACTAAATGCATATTAACAAATGCAAAGAAACATGCA[G/T]
AGTAGTCCATCTAGTTCTAGAATAAAGATTCATCAGGTAAAATTTTACTCTACATAATACTGCTACTTAAATTAGATCCTCTCAACCTGAGATTGCTAAT

Reverse complement sequence

ATTAGCAATCTCAGGTTGAGAGGATCTAATTTAAGTAGCAGTATTATGTAGAGTAAAATTTTACCTGATGAATCTTTATTCTAGAACTAGATGGACTACT[C/A]
TGCATGTTTCTTTGCATTTGTTAATATGCATTTAGTTCATCTTACAGAACTAGATGAGCTGATGTACCCATTTGATCTCTCTAACATGTTTATGTACAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.10%	0.23%	0.34%	NA
All Indica	2759	96.20%	3.20%	0.22%	0.40%	NA
All Japonica	1512	0.50%	99.30%	0.20%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	96.50%	3.00%	0.17%	0.34%	NA
Indica II	465	92.30%	7.10%	0.43%	0.22%	NA
Indica III	913	99.50%	0.30%	0.11%	0.11%	NA
Indica Intermediate	786	94.40%	4.50%	0.25%	0.89%	NA
Temperate Japonica	767	0.30%	99.60%	0.13%	0.00%	NA
Tropical Japonica	504	0.00%	99.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	34.40%	58.90%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725681375	G -> DEL	N	N	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N
vg0725681375	G -> T	LOC_Os07g42885.1	upstream_gene_variant ; 4630.0bp to feature; MODIFIER	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N
vg0725681375	G -> T	LOC_Os07g42890.1	downstream_gene_variant ; 1527.0bp to feature; MODIFIER	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N
vg0725681375	G -> T	LOC_Os07g42900.1	downstream_gene_variant ; 1898.0bp to feature; MODIFIER	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N
vg0725681375	G -> T	LOC_Os07g42890.2	downstream_gene_variant ; 1572.0bp to feature; MODIFIER	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N
vg0725681375	G -> T	LOC_Os07g42895.1	intron_variant ; MODIFIER	silent_mutation	Average:71.344; most accessible tissue: Minghui63 flower, score: 85.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725681375	NA	1.53E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	2.34E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	1.06E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	1.96E-30	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	1.33E-39	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	8.83E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	1.22E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725681375	NA	7.86E-33	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251