| Variant ID: vg0725681159 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 25681159 |
| Reference Allele: GA | Alternative Allele: GAAA,GAA,G,GAAAA |
| Primary Allele: GA | Secondary Allele: GAAA |
Inferred Ancestral Allele: Not determined.
TAGTTGATTATCTAGTTTGCCAGAATTTGCATAACTAAGATAGTACATACAGGAAACTGACGTAATTTGCATCAACTTTGCTGATAAACTATCAGATTTA[GA/GAAA,GAA,G,GAAAA]
AAAAAAAAACAAAAGAACACAAGAAATTTACTAACCATGGAATCATCAATAACCAGATCCTTCATTTGGACATCCATAAGCTTCCACAATCCATTGAATC
GATTCAATGGATTGTGGAAGCTTATGGATGTCCAAATGAAGGATCTGGTTATTGATGATTCCATGGTTAGTAAATTTCTTGTGTTCTTTTGTTTTTTTTT[TC/TTTC,TTC,C,TTTTC]
TAAATCTGATAGTTTATCAGCAAAGTTGATGCAAATTACGTCAGTTTCCTGTATGTACTATCTTAGTTATGCAAATTCTGGCAAACTAGATAATCAACTA
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of GAAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 2.30% | 0.99% | 0.00% | GAA: 0.74%; G: 0.49%; GAAAA: 0.04% |
| All Indica | 2759 | 98.70% | 0.70% | 0.07% | 0.00% | GAA: 0.47% |
| All Japonica | 1512 | 96.00% | 0.00% | 2.45% | 0.00% | G: 1.52%; GAA: 0.07% |
| Aus | 269 | 56.50% | 33.10% | 1.86% | 0.00% | GAA: 7.81%; GAAAA: 0.74% |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.00% | 0.11% | 0.00% | GAA: 0.66% |
| Indica Intermediate | 786 | 98.10% | 1.00% | 0.00% | 0.00% | GAA: 0.89% |
| Temperate Japonica | 767 | 93.00% | 0.00% | 4.04% | 0.00% | G: 3.00% |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 2.07% | 0.00% | GAA: 0.41% |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725681159 | GA -> GAAAA | LOC_Os07g42885.1 | upstream_gene_variant ; 4416.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAAA | LOC_Os07g42890.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAAA | LOC_Os07g42900.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAAA | LOC_Os07g42890.2 | downstream_gene_variant ; 1358.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAAA | LOC_Os07g42895.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAA | LOC_Os07g42885.1 | upstream_gene_variant ; 4416.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAA | LOC_Os07g42890.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAA | LOC_Os07g42900.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAA | LOC_Os07g42890.2 | downstream_gene_variant ; 1358.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAA | LOC_Os07g42895.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAA | LOC_Os07g42885.1 | upstream_gene_variant ; 4416.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAA | LOC_Os07g42890.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAA | LOC_Os07g42900.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAA | LOC_Os07g42890.2 | downstream_gene_variant ; 1358.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> GAAA | LOC_Os07g42895.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> G | LOC_Os07g42885.1 | upstream_gene_variant ; 4415.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> G | LOC_Os07g42890.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> G | LOC_Os07g42900.1 | downstream_gene_variant ; 2113.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> G | LOC_Os07g42890.2 | downstream_gene_variant ; 1357.0bp to feature; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |
| vg0725681159 | GA -> G | LOC_Os07g42895.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.393; most accessible tissue: Minghui63 flower, score: 62.973 | N | N | N | N |