Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725680887:

Variant ID: vg0725680887 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25680887
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAGAAAATATCTTCTATGCAATGATGATTACAGAACAGAGTATTTCAAAGGTCCATTCGTTTCATTGACTCGTCCAAGTTCTGTAAAAAAAAAATATA[A/T]
ATAGTTCAAATGATCAATATTTCTAAGCAAAAAAAAGATACATTTTTTCTAAAATAAAGCATTAATAAAGCTTTCTAAAATATTGAATTATTGGTGATGA

Reverse complement sequence

TCATCACCAATAATTCAATATTTTAGAAAGCTTTATTAATGCTTTATTTTAGAAAAAATGTATCTTTTTTTTGCTTAGAAATATTGATCATTTGAACTAT[T/A]
TATATTTTTTTTTTACAGAACTTGGACGAGTCAATGAAACGAATGGACCTTTGAAATACTCTGTTCTGTAATCATCATTGCATAGAAGATATTTTCTAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.30% 0.02% 0.00% NA
All Indica  2759 99.50% 0.40% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725680887 A -> T LOC_Os07g42885.1 upstream_gene_variant ; 4142.0bp to feature; MODIFIER N Average:37.281; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0725680887 A -> T LOC_Os07g42890.1 downstream_gene_variant ; 1039.0bp to feature; MODIFIER N Average:37.281; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0725680887 A -> T LOC_Os07g42900.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER N Average:37.281; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0725680887 A -> T LOC_Os07g42890.2 downstream_gene_variant ; 1084.0bp to feature; MODIFIER N Average:37.281; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0725680887 A -> T LOC_Os07g42895.1 intron_variant ; MODIFIER N Average:37.281; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N