| Variant ID: vg0725680883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25680883 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.07, others allele: 0.00, population size: 107. )
CGAAGCTAGAAAATATCTTCTATGCAATGATGATTACAGAACAGAGTATTTCAAAGGTCCATTCGTTTCATTGACTCGTCCAAGTTCTGTAAAAAAAAAA[T/G]
ATAAATAGTTCAAATGATCAATATTTCTAAGCAAAAAAAAGATACATTTTTTCTAAAATAAAGCATTAATAAAGCTTTCTAAAATATTGAATTATTGGTG
CACCAATAATTCAATATTTTAGAAAGCTTTATTAATGCTTTATTTTAGAAAAAATGTATCTTTTTTTTGCTTAGAAATATTGATCATTTGAACTATTTAT[A/C]
TTTTTTTTTTACAGAACTTGGACGAGTCAATGAAACGAATGGACCTTTGAAATACTCTGTTCTGTAATCATCATTGCATAGAAGATATTTTCTAGCTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.10% | 0.32% | 0.23% | NA |
| All Indica | 2759 | 96.20% | 3.20% | 0.25% | 0.33% | NA |
| All Japonica | 1512 | 0.40% | 99.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 92.30% | 7.10% | 0.22% | 0.43% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 94.70% | 4.50% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 99.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 36.70% | 56.70% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725680883 | T -> DEL | N | N | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0725680883 | T -> G | LOC_Os07g42885.1 | upstream_gene_variant ; 4138.0bp to feature; MODIFIER | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0725680883 | T -> G | LOC_Os07g42890.1 | downstream_gene_variant ; 1035.0bp to feature; MODIFIER | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0725680883 | T -> G | LOC_Os07g42900.1 | downstream_gene_variant ; 2390.0bp to feature; MODIFIER | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0725680883 | T -> G | LOC_Os07g42890.2 | downstream_gene_variant ; 1080.0bp to feature; MODIFIER | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0725680883 | T -> G | LOC_Os07g42895.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.011; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725680883 | NA | 2.44E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 1.60E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 8.38E-20 | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 2.32E-14 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 3.14E-31 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 5.73E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 4.44E-26 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 5.91E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 4.08E-40 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 3.01E-27 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 3.02E-13 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 3.80E-24 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725680883 | NA | 1.51E-33 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |