Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714435734:

Variant ID: vg0714435734 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14435734
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTGTAACTGTTCATGCATTGCCCTCTGAACCTCGAAGGTCAAGTCTAAACCAAATAACTTTGGAAGAGATTCCTATAGTCCGGGAGTACCCTGATGTG[T/C]
TCCCTGATGATTTACCTGGTATGCCGCCTAAAAGGGATATAGAGTTCAGAATAGATCTGGTGCCAGGAACAACTCTGATCCATAAGCGACCATATAGAAT

Reverse complement sequence

ATTCTATATGGTCGCTTATGGATCAGAGTTGTTCCTGGCACCAGATCTATTCTGAACTCTATATCCCTTTTAGGCGGCATACCAGGTAAATCATCAGGGA[A/G]
CACATCAGGGTACTCCCGGACTATAGGAATCTCTTCCAAAGTTATTTGGTTTAGACTTGACCTTCGAGGTTCAGAGGGCAATGCATGAACAGTTACAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 0.80% 2.14% 29.60% NA
All Indica  2759 54.10% 0.00% 3.15% 42.73% NA
All Japonica  1512 93.00% 2.20% 0.73% 4.03% NA
Aus  269 48.70% 0.40% 0.37% 50.56% NA
Indica I  595 59.50% 0.20% 1.18% 39.16% NA
Indica II  465 60.60% 0.00% 3.23% 36.13% NA
Indica III  913 41.90% 0.00% 5.15% 52.90% NA
Indica Intermediate  786 60.20% 0.00% 2.29% 37.53% NA
Temperate Japonica  767 96.10% 1.60% 0.91% 1.43% NA
Tropical Japonica  504 96.20% 0.40% 0.20% 3.17% NA
Japonica Intermediate  241 76.30% 8.30% 1.24% 14.11% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 83.30% 1.10% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714435734 T -> DEL LOC_Os07g25270.1 N frameshift_variant Average:8.263; most accessible tissue: Callus, score: 36.188 N N N N
vg0714435734 T -> C LOC_Os07g25270.1 missense_variant ; p.Phe113Leu; MODERATE nonsynonymous_codon ; F113L Average:8.263; most accessible tissue: Callus, score: 36.188 benign 0.656 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714435734 5.96E-06 NA mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 8.47E-07 NA mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 8.19E-07 NA mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 2.41E-08 1.05E-07 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 1.35E-06 NA mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 1.84E-07 2.24E-06 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714435734 8.33E-08 4.91E-09 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251