Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0708109465:

Variant ID: vg0708109465 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8109465
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.02, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAACATAAACACTGAAGTATAAAGTGGGACATGGCTTTGGGCCAAGTGCACTTCTTGTGCTAGCTGAGCCAACCTAGTCAAGATAAAAGAAGGGACCG[A/G]
GAGGGTATACATGTGAAAGGAATAAGTCTATTTTACCTCCCTCATCTCTTGCTCGTAATTGAAACGCTTCCTTCAAACATCGATTTGTACCCATTTCGAA

Reverse complement sequence

TTCGAAATGGGTACAAATCGATGTTTGAAGGAAGCGTTTCAATTACGAGCAAGAGATGAGGGAGGTAAAATAGACTTATTCCTTTCACATGTATACCCTC[T/C]
CGGTCCCTTCTTTTATCTTGACTAGGTTGGCTCAGCTAGCACAAGAAGTGCACTTGGCCCAAAGCCATGTCCCACTTTATACTTCAGTGTTTATGTTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 19.70% 0.78% 39.46% NA
All Indica  2759 38.40% 1.30% 0.87% 59.41% NA
All Japonica  1512 30.70% 57.10% 0.66% 11.57% NA
Aus  269 95.90% 1.50% 0.74% 1.86% NA
Indica I  595 9.20% 0.70% 2.69% 87.39% NA
Indica II  465 66.50% 3.40% 0.22% 29.89% NA
Indica III  913 45.00% 0.40% 0.33% 54.22% NA
Indica Intermediate  786 36.10% 1.70% 0.51% 61.70% NA
Temperate Japonica  767 5.90% 79.10% 0.39% 14.60% NA
Tropical Japonica  504 68.10% 20.80% 0.40% 10.71% NA
Japonica Intermediate  241 31.50% 62.70% 2.07% 3.73% NA
VI/Aromatic  96 79.20% 0.00% 0.00% 20.83% NA
Intermediate  90 42.20% 27.80% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708109465 A -> DEL N N silent_mutation Average:14.261; most accessible tissue: Callus, score: 95.217 N N N N
vg0708109465 A -> G LOC_Os07g14220.1 upstream_gene_variant ; 4233.0bp to feature; MODIFIER silent_mutation Average:14.261; most accessible tissue: Callus, score: 95.217 N N N N
vg0708109465 A -> G LOC_Os07g14230.1 upstream_gene_variant ; 715.0bp to feature; MODIFIER silent_mutation Average:14.261; most accessible tissue: Callus, score: 95.217 N N N N
vg0708109465 A -> G LOC_Os07g14230-LOC_Os07g14240 intergenic_region ; MODIFIER silent_mutation Average:14.261; most accessible tissue: Callus, score: 95.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708109465 NA 6.28E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708109465 NA 7.28E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708109465 NA 3.84E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708109465 3.61E-06 NA mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708109465 NA 1.60E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708109465 NA 7.24E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251