Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701643483:

Variant ID: vg0701643483 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1643483
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGGATTTAGGCCAAGACATGGTAGAAGCAGTCGGTAATTTACATCTCTTGGCTGCCATGAAGTCCAACAACATCGACATTAGGTGTTCGCCATTTTCT[C/T]
GGAAAAGTTGCATCACTCCCATCTTGAAAATTGAAGATGTCACTTGCAAACTATGGTACCAGCATAGACTATATTATTGCAGGTGAAGAAGAAATAGACC

Reverse complement sequence

GGTCTATTTCTTCTTCACCTGCAATAATATAGTCTATGCTGGTACCATAGTTTGCAAGTGACATCTTCAATTTTCAAGATGGGAGTGATGCAACTTTTCC[G/A]
AGAAAATGGCGAACACCTAATGTCGATGTTGTTGGACTTCATGGCAGCCAAGAGATGTAAATTACCGACTGCTTCTACCATGTCTTGGCCTAAATCCTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	4.10%	0.49%	57.70%	NA
All Indica	2759	54.90%	0.80%	0.33%	43.89%	NA
All Japonica	1512	10.70%	0.00%	0.79%	88.49%	NA
Aus	269	5.20%	62.80%	0.37%	31.60%	NA
Indica I	595	62.20%	0.20%	0.50%	37.14%	NA
Indica II	465	45.20%	0.20%	0.43%	54.19%	NA
Indica III	913	56.60%	0.40%	0.22%	42.72%	NA
Indica Intermediate	786	53.30%	2.20%	0.25%	44.27%	NA
Temperate Japonica	767	16.90%	0.00%	1.43%	81.62%	NA
Tropical Japonica	504	4.20%	0.00%	0.00%	95.83%	NA
Japonica Intermediate	241	4.60%	0.00%	0.41%	95.02%	NA
VI/Aromatic	96	44.80%	1.00%	1.04%	53.12%	NA
Intermediate	90	51.10%	2.20%	0.00%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701643483	C -> DEL	N	N	silent_mutation	Average:10.625; most accessible tissue: Callus, score: 57.376	N	N	N	N
vg0701643483	C -> T	LOC_Os07g03920.1	upstream_gene_variant ; 231.0bp to feature; MODIFIER	silent_mutation	Average:10.625; most accessible tissue: Callus, score: 57.376	N	N	N	N
vg0701643483	C -> T	LOC_Os07g03910.1	downstream_gene_variant ; 4873.0bp to feature; MODIFIER	silent_mutation	Average:10.625; most accessible tissue: Callus, score: 57.376	N	N	N	N
vg0701643483	C -> T	LOC_Os07g03930.1	downstream_gene_variant ; 3530.0bp to feature; MODIFIER	silent_mutation	Average:10.625; most accessible tissue: Callus, score: 57.376	N	N	N	N
vg0701643483	C -> T	LOC_Os07g03920-LOC_Os07g03930	intergenic_region ; MODIFIER	silent_mutation	Average:10.625; most accessible tissue: Callus, score: 57.376	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701643483	NA	2.57E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	8.22E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	7.10E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	3.66E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	3.52E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	8.29E-08	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	7.53E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.95E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	2.64E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.33E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	2.09E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.53E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	9.69E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.39E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	5.75E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	2.18E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.71E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	9.85E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	4.61E-06	mr1474	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	4.61E-06	mr1475	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.70E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	4.00E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	3.33E-44	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	8.90E-55	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.17E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	2.78E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	3.99E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	4.16E-45	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.49E-08	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	4.20E-10	mr1774	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	7.84E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	2.62E-10	mr1931	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.29E-07	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	8.17E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.76E-43	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	6.20E-59	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	1.71E-34	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643483	NA	3.02E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251