\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507081467:

Variant ID: vg0507081467 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7081467
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CAGACATCCCATCTATTTTGGTACCAGAACAAAAGAACCTGAGAGGGTTGGTCACCATGTGTTTGCTAAGAAATGCGCTGCCAGTAGATGACAAATAACT[C/T]
ACAGGATTGTGGTGAGGTCGAACTGAACAATTGGAGGAGGGGCAGCACTCAGATTGAAGGAGGGGACATGTACCTATAACAGAAAAGTTTGTTAATAGTG

Reverse complement sequence

CACTATTAACAAACTTTTCTGTTATAGGTACATGTCCCCTCCTTCAATCTGAGTGCTGCCCCTCCTCCAATTGTTCAGTTCGACCTCACCACAATCCTGT[G/A]
AGTTATTTGTCATCTACTGGCAGCGCATTTCTTAGCAAACACATGGTGACCAACCCTCTCAGGTTCTTTTGTTCTGGTACCAAAATAGATGGGATGTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.20% 0.11% 0.55% NA
All Indica  2759 60.80% 38.30% 0.11% 0.76% NA
All Japonica  1512 59.90% 39.80% 0.13% 0.20% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 83.00% 16.80% 0.00% 0.17% NA
Indica II  465 26.70% 72.50% 0.22% 0.65% NA
Indica III  913 58.40% 40.20% 0.22% 1.20% NA
Indica Intermediate  786 66.90% 32.30% 0.00% 0.76% NA
Temperate Japonica  767 90.50% 9.40% 0.00% 0.13% NA
Tropical Japonica  504 13.70% 85.70% 0.40% 0.20% NA
Japonica Intermediate  241 58.90% 40.70% 0.00% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507081467 C -> T LOC_Os05g12310.1 upstream_gene_variant ; 3109.0bp to feature; MODIFIER silent_mutation Average:70.362; most accessible tissue: Callus, score: 82.695 N N N N
vg0507081467 C -> T LOC_Os05g12320.1 upstream_gene_variant ; 1416.0bp to feature; MODIFIER silent_mutation Average:70.362; most accessible tissue: Callus, score: 82.695 N N N N
vg0507081467 C -> T LOC_Os05g12310-LOC_Os05g12320 intergenic_region ; MODIFIER silent_mutation Average:70.362; most accessible tissue: Callus, score: 82.695 N N N N
vg0507081467 C -> DEL N N silent_mutation Average:70.362; most accessible tissue: Callus, score: 82.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507081467 NA 7.86E-17 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507081467 NA 5.34E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507081467 1.77E-06 NA mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 2.80E-06 8.67E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 2.14E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 7.81E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 3.98E-06 4.12E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 4.14E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 1.76E-43 3.36E-79 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 6.40E-32 1.23E-61 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 1.49E-16 4.67E-39 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 4.92E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 5.61E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 8.18E-11 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 1.59E-11 2.36E-22 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 1.83E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 6.63E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 1.16E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 9.79E-08 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 1.59E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 9.98E-06 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 2.09E-10 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 7.39E-52 3.63E-104 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 2.39E-36 3.08E-74 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 4.21E-24 9.08E-61 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 NA 1.49E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 5.19E-09 2.04E-22 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507081467 4.09E-09 9.03E-13 mr1807_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251