\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433192266:

Variant ID: vg0433192266 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33192266
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATTGAGTTGGGAATGGCGTAATGACGGATTATTATTTTTTAGATAATGAAATATAATATCCCGGCCTTTGCTCAAAAAGAACTACAGCCAATTATTA[T/C,A]
AAAGATCCACTCCAGAAGAGAGTGTAGTTCAAGACAAGTTGAACACACCAAACAAGAGAAGAAATGACCCAAACTGAGAAAAGCAAAACAAAATGTGGAG

Reverse complement sequence

CTCCACATTTTGTTTTGCTTTTCTCAGTTTGGGTCATTTCTTCTCTTGTTTGGTGTGTTCAACTTGTCTTGAACTACACTCTCTTCTGGAGTGGATCTTT[A/G,T]
TAATAATTGGCTGTAGTTCTTTTTGAGCAAAGGCCGGGATATTATATTTCATTATCTAAAAAATAATAATCCGTCATTACGCCATTCCCAACTCAATGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.40% 0.23% 0.44% A: 0.02%
All Indica  2759 82.50% 17.00% 0.40% 0.07% A: 0.04%
All Japonica  1512 4.30% 94.40% 0.00% 1.26% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 92.30% 7.10% 0.50% 0.17% NA
Indica II  465 94.80% 4.70% 0.43% 0.00% NA
Indica III  913 70.40% 29.10% 0.33% 0.00% A: 0.11%
Indica Intermediate  786 81.90% 17.60% 0.38% 0.13% NA
Temperate Japonica  767 1.30% 96.20% 0.00% 2.48% NA
Tropical Japonica  504 6.50% 93.50% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433192266 T -> C LOC_Os04g55760.1 upstream_gene_variant ; 357.0bp to feature; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> C LOC_Os04g55770.1 downstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> C LOC_Os04g55750-LOC_Os04g55760 intergenic_region ; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> DEL N N silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> A LOC_Os04g55760.1 upstream_gene_variant ; 357.0bp to feature; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> A LOC_Os04g55770.1 downstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0433192266 T -> A LOC_Os04g55750-LOC_Os04g55760 intergenic_region ; MODIFIER silent_mutation Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433192266 4.49E-06 4.49E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 5.26E-07 2.06E-07 mr1022 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 7.69E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 1.79E-06 1.79E-06 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 5.21E-06 NA mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 3.91E-07 NA mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 9.63E-07 NA mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 6.93E-06 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 4.42E-07 4.42E-07 mr1542 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 5.85E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 7.83E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 3.58E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.75E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 3.44E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.72E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.88E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 8.65E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 7.64E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.65E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 2.93E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.72E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.16E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.08E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 7.40E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 8.09E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 5.89E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.68E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.59E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.26E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.16E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.30E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 9.71E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 2.34E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.80E-22 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.86E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 3.86E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 3.04E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 4.12E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 1.03E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 6.64E-23 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 2.42E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266 NA 7.39E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251