Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433192266:

Variant ID: vg0433192266 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 33192266
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GTCATTGAGTTGGGAATGGCGTAATGACGGATTATTATTTTTTAGATAATGAAATATAATATCCCGGCCTTTGCTCAAAAAGAACTACAGCCAATTATTA[T/C,A]
AAAGATCCACTCCAGAAGAGAGTGTAGTTCAAGACAAGTTGAACACACCAAACAAGAGAAGAAATGACCCAAACTGAGAAAAGCAAAACAAAATGTGGAG

Reverse complement sequence

CTCCACATTTTGTTTTGCTTTTCTCAGTTTGGGTCATTTCTTCTCTTGTTTGGTGTGTTCAACTTGTCTTGAACTACACTCTCTTCTGGAGTGGATCTTT[A/G,T]
TAATAATTGGCTGTAGTTCTTTTTGAGCAAAGGCCGGGATATTATATTTCATTATCTAAAAAATAATAATCCGTCATTACGCCATTCCCAACTCAATGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	45.40%	0.23%	0.44%	A: 0.02%
All Indica	2759	82.50%	17.00%	0.40%	0.07%	A: 0.04%
All Japonica	1512	4.30%	94.40%	0.00%	1.26%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	92.30%	7.10%	0.50%	0.17%	NA
Indica II	465	94.80%	4.70%	0.43%	0.00%	NA
Indica III	913	70.40%	29.10%	0.33%	0.00%	A: 0.11%
Indica Intermediate	786	81.90%	17.60%	0.38%	0.13%	NA
Temperate Japonica	767	1.30%	96.20%	0.00%	2.48%	NA
Tropical Japonica	504	6.50%	93.50%	0.00%	0.00%	NA
Japonica Intermediate	241	9.10%	90.90%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0433192266	T -> C	LOC_Os04g55760.1	upstream_gene_variant ; 357.0bp to feature; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> C	LOC_Os04g55770.1	downstream_gene_variant ; 4252.0bp to feature; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> C	LOC_Os04g55750-LOC_Os04g55760	intergenic_region ; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> DEL	N	N	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> A	LOC_Os04g55760.1	upstream_gene_variant ; 357.0bp to feature; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> A	LOC_Os04g55770.1	downstream_gene_variant ; 4252.0bp to feature; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0433192266	T -> A	LOC_Os04g55750-LOC_Os04g55760	intergenic_region ; MODIFIER	silent_mutation	Average:34.724; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0433192266	4.49E-06	4.49E-06	mr1008	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	5.26E-07	2.06E-07	mr1022	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	7.69E-06	NA	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	1.79E-06	1.79E-06	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	5.21E-06	NA	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	3.91E-07	NA	mr1132	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	9.63E-07	NA	mr1142	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	6.93E-06	NA	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	4.42E-07	4.42E-07	mr1542	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	5.85E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	7.83E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	3.58E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.75E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	3.44E-14	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.72E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.88E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	8.65E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	7.64E-12	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.65E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	2.93E-22	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.72E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.16E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.08E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	7.40E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	8.09E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	5.89E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.68E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.59E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.26E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.16E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.30E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	9.71E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	2.34E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.80E-22	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.86E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	3.86E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	3.04E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	4.12E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	1.03E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	6.64E-23	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	2.42E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433192266	NA	7.39E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251