Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431530955:

Variant ID: vg0431530955 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31530955
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AGACAAAATAACCAATGATCATGGCTATCGTCGTGCTCCTACTCCTTCCATCTCATTTTAGGTGGAAATGTGGGTCTCCGTGTCTAATGTTTAACTGTCC[G/A]
CCTTATTTGAAAATTTTATTAAAAATTAAAAAATAAGTCATGCATAAAAAAATATTTATGTTTTAATTTTAATAATAATAAAATACTAGCTATAAAAAAT

Reverse complement sequence

ATTTTTTATAGCTAGTATTTTATTATTATTAAAATTAAAACATAAATATTTTTTTATGCATGACTTATTTTTTAATTTTTAATAAAATTTTCAAATAAGG[C/T]
GGACAGTTAAACATTAGACACGGAGACCCACATTTCCACCTAAAATGAGATGGAAGGAGTAGGAGCACGACGATAGCCATGATCATTGGTTATTTTGTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.30%	0.04%	0.36%	NA
All Indica	2759	95.00%	4.70%	0.04%	0.22%	NA
All Japonica	1512	79.20%	20.00%	0.07%	0.73%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	95.30%	4.20%	0.17%	0.34%	NA
Indica II	465	91.80%	8.00%	0.00%	0.22%	NA
Indica III	913	99.10%	0.50%	0.00%	0.33%	NA
Indica Intermediate	786	92.00%	8.00%	0.00%	0.00%	NA
Temperate Japonica	767	94.80%	3.80%	0.00%	1.43%	NA
Tropical Japonica	504	49.40%	50.40%	0.20%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431530955	G -> DEL	N	N	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N
vg0431530955	G -> A	LOC_Os04g52930.1	upstream_gene_variant ; 1461.0bp to feature; MODIFIER	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N
vg0431530955	G -> A	LOC_Os04g52940.1	upstream_gene_variant ; 950.0bp to feature; MODIFIER	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N
vg0431530955	G -> A	LOC_Os04g52920.1	downstream_gene_variant ; 3094.0bp to feature; MODIFIER	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N
vg0431530955	G -> A	LOC_Os04g52920.2	downstream_gene_variant ; 3094.0bp to feature; MODIFIER	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N
vg0431530955	G -> A	LOC_Os04g52930-LOC_Os04g52940	intergenic_region ; MODIFIER	silent_mutation	Average:77.575; most accessible tissue: Callus, score: 84.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431530955	NA	9.86E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	5.10E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	7.09E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	2.05E-10	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	5.68E-08	mr1328	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	1.21E-06	1.21E-06	mr1398	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	3.55E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	4.79E-07	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	7.71E-09	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431530955	NA	2.87E-06	mr1989	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251