\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430942143:

Variant ID: vg0430942143 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30942143
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCATCAAGGCATCAACTCATCAACTCCACTGGTATATCCCGTAGTAAGAGCAGGTACAGTAGCATTCATAAACATATTTTAAAGAGATAAATAAAAAAA[A/G]
AGAAGAGCAACGGTTATAACGGTTATAAATCTATAGCACGAACTCTAATATGTAATGTGTGTATGACAGATAGGACCAAGTATCAATAGTATAGTAAGCA

Reverse complement sequence

TGCTTACTATACTATTGATACTTGGTCCTATCTGTCATACACACATTACATATTAGAGTTCGTGCTATAGATTTATAACCGTTATAACCGTTGCTCTTCT[T/C]
TTTTTTTATTTATCTCTTTAAAATATGTTTATGAATGCTACTGTACCTGCTCTTACTACGGGATATACCAGTGGAGTTGATGAGTTGATGCCTTGATGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 31.40% 1.42% 0.00% NA
All Indica  2759 94.40% 3.90% 1.74% 0.00% NA
All Japonica  1512 27.50% 71.40% 1.06% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 95.80% 0.70% 3.53% 0.00% NA
Indica II  465 89.90% 7.50% 2.58% 0.00% NA
Indica III  913 96.50% 3.10% 0.44% 0.00% NA
Indica Intermediate  786 93.50% 5.10% 1.40% 0.00% NA
Temperate Japonica  767 41.90% 56.20% 1.96% 0.00% NA
Tropical Japonica  504 11.70% 88.10% 0.20% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 51.00% 2.08% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430942143 A -> G LOC_Os04g52090.1 downstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 flower, score: 99.067 N N N N
vg0430942143 A -> G LOC_Os04g52100.1 downstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 flower, score: 99.067 N N N N
vg0430942143 A -> G LOC_Os04g52090-LOC_Os04g52100 intergenic_region ; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 flower, score: 99.067 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430942143 A G 0.01 0.0 -0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430942143 NA 3.62E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 9.81E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 5.50E-11 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 3.70E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 8.23E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 1.15E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 9.97E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 8.83E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 2.90E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 9.63E-06 9.63E-06 mr1355_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 7.40E-06 7.39E-06 mr1452_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 1.68E-06 3.31E-19 mr1666_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 4.51E-06 mr1666_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 2.55E-08 2.66E-18 mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 8.61E-06 6.32E-09 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 3.43E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430942143 NA 4.20E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251