\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430673467:

Variant ID: vg0430673467 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30673467
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTACAGCAGGCCAAAGCGGTATCAAATCGTCACCGTTGAGTGGATAGGATCCAACGGCTGTCATCGCTAGGTACCGCGAGGTACCAACTCGTCCTTGT[A/G]
GTGGCACTGTATTAGGATGTGGAGGTGGAAGGGTATTTCTGTATTTTCGCATGGCTGATTCTGTCTTATCCACTTTGATCGTTTCGTCCGACGCCGCCTC

Reverse complement sequence

GAGGCGGCGTCGGACGAAACGATCAAAGTGGATAAGACAGAATCAGCCATGCGAAAATACAGAAATACCCTTCCACCTCCACATCCTAATACAGTGCCAC[T/C]
ACAAGGACGAGTTGGTACCTCGCGGTACCTAGCGATGACAGCCGTTGGATCCTATCCACTCAACGGTGACGATTTGATACCGCTTTGGCCTGCTGTACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 12.70% 4.61% 13.12% NA
All Indica  2759 87.70% 0.90% 2.17% 9.21% NA
All Japonica  1512 38.40% 36.80% 4.63% 20.17% NA
Aus  269 85.10% 0.40% 9.29% 5.20% NA
Indica I  595 98.70% 0.20% 0.00% 1.18% NA
Indica II  465 81.90% 3.20% 1.08% 13.76% NA
Indica III  913 82.80% 0.20% 4.49% 12.49% NA
Indica Intermediate  786 88.40% 1.00% 1.78% 8.78% NA
Temperate Japonica  767 34.80% 61.80% 1.04% 2.35% NA
Tropical Japonica  504 35.90% 6.50% 10.12% 47.42% NA
Japonica Intermediate  241 54.80% 20.70% 4.56% 19.92% NA
VI/Aromatic  96 13.50% 0.00% 59.38% 27.08% NA
Intermediate  90 54.40% 15.60% 6.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430673467 A -> DEL LOC_Os04g51760.1 N frameshift_variant Average:60.711; most accessible tissue: Zhenshan97 flag leaf, score: 94.38 N N N N
vg0430673467 A -> G LOC_Os04g51760.1 missense_variant ; p.Leu141Pro; MODERATE nonsynonymous_codon ; L141P Average:60.711; most accessible tissue: Zhenshan97 flag leaf, score: 94.38 benign -1.489 TOLERATED 0.26

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430673467 A G 0.05 0.07 0.07 0.06 0.06 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430673467 NA 4.23E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 4.99E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 3.06E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.47E-11 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.44E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 2.63E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.54E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 1.02E-06 1.83E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.77E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.14E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 4.37E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 1.72E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 NA 9.61E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 6.51E-08 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673467 5.50E-06 3.97E-14 mr1530_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251