\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424045979:

Variant ID: vg0424045979 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24045979
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCCTCTCTTCACTCTCTCTCTTAATTAATATAGTGTCACATAAGCAACAAGTTTTACATGGTAATGTAGTTAATGCTATAGACACCATAGGTTTCGA[T/C]
AAAAATTTAATGAGATGTGAAATGTGTAGCTAGTTTCCGTCTACGAGTTAGGAGACATATCCGCGCGGTGTGAAAGTGGTGCGCGCGCGCATATCGCGTC

Reverse complement sequence

GACGCGATATGCGCGCGCGCACCACTTTCACACCGCGCGGATATGTCTCCTAACTCGTAGACGGAAACTAGCTACACATTTCACATCTCATTAAATTTTT[A/G]
TCGAAACCTATGGTGTCTATAGCATTAACTACATTACCATGTAAAACTTGTTGCTTATGTGACACTATATTAATTAAGAGAGAGAGTGAAGAGAGGAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 33.60% 6.31% 11.17% NA
All Indica  2759 66.90% 7.00% 7.36% 18.81% NA
All Japonica  1512 21.00% 73.70% 5.36% 0.00% NA
Aus  269 39.00% 58.00% 2.97% 0.00% NA
Indica I  595 96.50% 1.70% 1.18% 0.67% NA
Indica II  465 21.90% 9.90% 19.57% 48.60% NA
Indica III  913 73.90% 4.90% 3.61% 17.52% NA
Indica Intermediate  786 62.80% 11.60% 9.16% 16.41% NA
Temperate Japonica  767 37.80% 53.70% 8.47% 0.00% NA
Tropical Japonica  504 0.60% 98.60% 0.79% 0.00% NA
Japonica Intermediate  241 10.00% 85.10% 4.98% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 35.60% 47.80% 6.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424045979 T -> C LOC_Os04g40450.1 upstream_gene_variant ; 4894.0bp to feature; MODIFIER silent_mutation Average:72.208; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0424045979 T -> C LOC_Os04g40470.1 downstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:72.208; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0424045979 T -> C LOC_Os04g40460.1 intron_variant ; MODIFIER silent_mutation Average:72.208; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0424045979 T -> DEL N N silent_mutation Average:72.208; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424045979 NA 7.36E-06 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 9.93E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 7.89E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 4.92E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 5.69E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 8.02E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 8.40E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 3.20E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 7.64E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 2.69E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 9.71E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 8.36E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 1.08E-08 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 7.62E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 3.85E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 1.73E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 1.63E-07 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 4.96E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 3.25E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 7.87E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 5.53E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 6.03E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 4.79E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 8.94E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 3.08E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 9.50E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 7.58E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 3.98E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 2.30E-09 mr1596_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 1.83E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 9.58E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 1.86E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 2.24E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424045979 NA 2.07E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251