\
| Variant ID: vg0422578975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 22578975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACGGAAGAGCCAGCACAGGGGGTCCCTCGCTTCGACGGCACCCGGAGCTCAACTTAAGGCTGGAATACGGCTAGAAAACTTAGCCCCCATACTTGGCGAG[G/A]
AAACGTTCATGTAGATGAGAGAGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAACACGCGAGCGTCGCAGGGCCATGAGAAAAGAATGGG
CCCATTCTTTTCTCATGGCCCTGCGACGCTCGCGTGTTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCTCTCTCATCTACATGAACGTTT[C/T]
CTCGCCAAGTATGGGGGCTAAGTTTTCTAGCCGTATTCCAGCCTTAAGTTGAGCTCCGGGTGCCGTCGAAGCGAGGGACCCCCTGTGCTGGCTCTTCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 6.60% | 0.25% | 0.89% | NA |
| All Indica | 2759 | 93.90% | 4.60% | 0.36% | 1.09% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.10% | 65.10% | 0.74% | 4.09% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.70% | 0.43% | 0.43% | NA |
| Indica III | 913 | 91.70% | 4.80% | 0.66% | 2.85% | NA |
| Indica Intermediate | 786 | 89.90% | 9.50% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0422578975 | G -> DEL | N | N | silent_mutation | Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0422578975 | G -> A | LOC_Os04g37960.1 | upstream_gene_variant ; 4481.0bp to feature; MODIFIER | silent_mutation | Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0422578975 | G -> A | LOC_Os04g37950-LOC_Os04g37960 | intergenic_region ; MODIFIER | silent_mutation | Average:46.713; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0422578975 | NA | 2.20E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 8.25E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 3.16E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 1.57E-13 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 2.09E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 3.87E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 3.86E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 3.50E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 5.73E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 2.41E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 9.70E-07 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | 1.78E-06 | 1.30E-09 | mr1393 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 7.74E-07 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 1.96E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 2.52E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 3.40E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 4.91E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 9.59E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 4.13E-07 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 1.23E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 1.51E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 5.87E-07 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 9.48E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 7.63E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 2.63E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 1.03E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422578975 | NA | 9.42E-06 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |