Search for Variation information by Variation ID:
Detailed information for vg0412512389:
| Variant ID: vg0412512389 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12512389 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 104. )
Flanking Sequence (100 bp) in Reference Genome:
TCACTTCTGATGCATTCACATGATTAGGTCTTAAAGGACCCAGTAGTTTGTTCCAACAGTCTTCTGTAGTGACATCCCAGACATCATCCAAAACAATCAG[A/G]
AACTTCTTAGATTTCATGTGTTTCTCAAGATCCTGCTGAAGCATGTTAAAGTTGCTTATTCCTTGGTAACTTCGGTTGGAGACACACCCTAAAATCTCCC
Reverse complement sequence
GGGAGATTTTAGGGTGTGTCTCCAACCGAAGTTACCAAGGAATAAGCAACTTTAACATGCTTCAGCAGGATCTTGAGAAACACATGAAATCTAAGAAGTT[T/C]
CTGATTGTTTTGGATGATGTCTGGGATGTCACTACAGAAGACTGTTGGAACAAACTACTGGGTCCTTTAAGACCTAATCATGTGAATGCATCAGAAGTGA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.60% | 17.30% | 1.63% | 34.47% | NA |
| All Indica | 2759 | 24.70% | 25.60% | 2.32% | 47.44% | NA |
| All Japonica | 1512 | 89.20% | 0.30% | 0.26% | 10.32% | NA |
| Aus | 269 | 18.60% | 33.80% | 2.23% | 45.35% | NA |
| Indica I | 595 | 46.20% | 28.20% | 1.68% | 23.87% | NA |
| Indica II | 465 | 28.80% | 12.00% | 2.58% | 56.56% | NA |
| Indica III | 913 | 6.80% | 30.00% | 2.74% | 60.46% | NA |
| Indica Intermediate | 786 | 26.70% | 26.30% | 2.16% | 44.78% | NA |
| Temperate Japonica | 767 | 98.60% | 0.40% | 0.26% | 0.78% | NA |
| Tropical Japonica | 504 | 72.00% | 0.00% | 0.20% | 27.78% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.40% | 0.41% | 4.15% | NA |
| VI/Aromatic | 96 | 72.90% | 5.20% | 0.00% | 21.88% | NA |
| Intermediate | 90 | 61.10% | 12.20% | 3.33% | 23.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412512389 | A -> DEL | LOC_Os04g22090.1 | N | frameshift_variant | Average:13.308; most accessible tissue: Callus, score: 29.995 | N | N | N | N |
| vg0412512389 | A -> G | LOC_Os04g22090.1 | synonymous_variant ; p.Phe178Phe; LOW | synonymous_codon | Average:13.308; most accessible tissue: Callus, score: 29.995 | N | N | N | N |
| vg0412512389 | A -> G | LOC_Os04g22090.1 | synonymous_variant ; p.Phe178Phe; LOW | nonsynonymous_codon ; F178L | Average:13.308; most accessible tissue: Callus, score: 29.995 | benign  |
1.293 |
DELETERIOUS | 0.04 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412512389 | 2.38E-07 | 4.11E-09 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 4.40E-06 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 1.06E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 1.77E-06 | mr1611_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | 3.52E-06 | 3.52E-06 | mr1670_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 9.31E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 7.31E-06 | mr1767_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | 8.99E-06 | 1.97E-07 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 2.64E-06 | mr1906_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 7.70E-07 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512389 | NA | 2.76E-06 | mr1960_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |