\
| Variant ID: vg0408293903 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8293903 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGAGAAAACCCTTCGCGGAGGAACTCGAGGTGCAGCTGCGGACGATGATCTCGTATGCAAGCCAACACATGCCCCCCGGCATATCGGCTTGACCGACGA[C/T]
ACTCCTGCTTCAAGGCTTCGTCGATACGTTGACCGATGCCTTCGAGCTGGGTGCAGGCGCCATTCAGCCACGAGATATATCCGGCCGCCGATTCCTCAGG
CCTGAGGAATCGGCGGCCGGATATATCTCGTGGCTGAATGGCGCCTGCACCCAGCTCGAAGGCATCGGTCAACGTATCGACGAAGCCTTGAAGCAGGAGT[G/A]
TCGTCGGTCAAGCCGATATGCCGGGGGGCATGTGTTGGCTTGCATACGAGATCATCGTCCGCAGCTGCACCTCGAGTTCCTCCGCGAAGGGTTTTCTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.40% | 2.30% | 5.71% | 53.60% | NA |
| All Indica | 2759 | 13.20% | 0.10% | 7.00% | 79.70% | NA |
| All Japonica | 1512 | 80.00% | 6.60% | 3.31% | 10.12% | NA |
| Aus | 269 | 45.00% | 0.00% | 4.09% | 50.93% | NA |
| Indica I | 595 | 4.00% | 0.00% | 5.55% | 90.42% | NA |
| Indica II | 465 | 36.60% | 0.20% | 8.17% | 55.05% | NA |
| Indica III | 913 | 8.90% | 0.10% | 8.21% | 82.80% | NA |
| Indica Intermediate | 786 | 11.30% | 0.10% | 5.98% | 82.57% | NA |
| Temperate Japonica | 767 | 97.30% | 0.00% | 0.26% | 2.48% | NA |
| Tropical Japonica | 504 | 53.40% | 19.80% | 7.94% | 18.85% | NA |
| Japonica Intermediate | 241 | 80.50% | 0.00% | 3.32% | 16.18% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 9.38% | 16.67% | NA |
| Intermediate | 90 | 53.30% | 7.80% | 7.78% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408293903 | C -> DEL | LOC_Os04g14780.1 | N | frameshift_variant | Average:22.946; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0408293903 | C -> T | LOC_Os04g14780.1 | missense_variant ; p.Cys497Tyr; MODERATE | nonsynonymous_codon ; C497Y | Average:22.946; most accessible tissue: Minghui63 panicle, score: 42.799 | probably damaging |
2.244 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408293903 | 1.10E-06 | NA | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 8.94E-07 | NA | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 7.24E-06 | NA | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.73E-07 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | NA | 8.22E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 7.55E-06 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | NA | 1.34E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | NA | 1.11E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.69E-06 | NA | mr1019_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.24E-07 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 5.89E-09 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 6.54E-07 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.87E-09 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.25E-08 | NA | mr1390_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 1.54E-06 | NA | mr1489_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408293903 | 6.50E-09 | NA | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |