\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404447879:

Variant ID: vg0404447879 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4447879
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAAGTTTTTTGCAATGAAAAATATAATAAAAAAAAGGGGAGTTGGCCCTTAGCAATTGATAAGATGCTCATATAGACCTAGATACTTTAAAAGGAA[G/A]
CATGAAATTGTCAATTACTGCAACAAATTTCAATTCAACCATTTTGAGGACAGATGAAGAACTCCTAAGAAGAATACATGGAAATTTTGTTAAACTGCAA

Reverse complement sequence

TTGCAGTTTAACAAAATTTCCATGTATTCTTCTTAGGAGTTCTTCATCTGTCCTCAAAATGGTTGAATTGAAATTTGTTGCAGTAATTGACAATTTCATG[C/T]
TTCCTTTTAAAGTATCTAGGTCTATATGAGCATCTTATCAATTGCTAAGGGCCAACTCCCCTTTTTTTTATTATATTTTTCATTGCAAAAAACTTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.50% 0.15% 0.00% NA
All Indica  2759 83.60% 16.20% 0.14% 0.00% NA
All Japonica  1512 88.70% 11.30% 0.00% 0.00% NA
Aus  269 61.30% 37.50% 1.12% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 71.70% 28.30% 0.00% 0.00% NA
Indica Intermediate  786 79.50% 20.00% 0.51% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 79.00% 21.00% 0.00% 0.00% NA
Japonica Intermediate  241 76.30% 23.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404447879 G -> A LOC_Os04g08320.1 upstream_gene_variant ; 3875.0bp to feature; MODIFIER silent_mutation Average:43.978; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0404447879 G -> A LOC_Os04g08330.1 upstream_gene_variant ; 919.0bp to feature; MODIFIER silent_mutation Average:43.978; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0404447879 G -> A LOC_Os04g08340.1 upstream_gene_variant ; 4817.0bp to feature; MODIFIER silent_mutation Average:43.978; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0404447879 G -> A LOC_Os04g08330-LOC_Os04g08340 intergenic_region ; MODIFIER silent_mutation Average:43.978; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404447879 NA 8.26E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 1.10E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 3.66E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 1.65E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 5.92E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 1.32E-06 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 6.99E-07 mr1072_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 7.09E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 9.38E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 1.21E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 3.15E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 4.10E-11 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 9.13E-07 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404447879 NA 1.25E-10 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251