Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329268317:

Variant ID: vg0329268317 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29268317
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

AAATACAGTCGTATCCTGGTATTGACCCTATAGTGCATCCTGGTATTGATCATAAAGTGCATTACTGACCTGTCTATGTCCCATCTGCTTGGTACATGGT[C/A]
TAATGTAAACACAGAAGTGCTAACTAGTGCCCTGCCCTCTGAGACTGTAAATACGTCCCCCAAACTAGTACTTCATCCGGCAAAAAATATGTGACATTTG

Reverse complement sequence

CAAATGTCACATATTTTTTGCCGGATGAAGTACTAGTTTGGGGGACGTATTTACAGTCTCAGAGGGCAGGGCACTAGTTAGCACTTCTGTGTTTACATTA[G/T]
ACCATGTACCAAGCAGATGGGACATAGACAGGTCAGTAATGCACTTTATGATCAATACCAGGATGCACTATAGGGTCAATACCAGGATACGACTGTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	9.70%	0.08%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	71.20%	28.60%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	21.20%	78.20%	0.60%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329268317	C -> A	LOC_Os03g51150.1	downstream_gene_variant ; 4003.0bp to feature; MODIFIER	silent_mutation	Average:56.428; most accessible tissue: Callus, score: 82.865	N	N	N	N
vg0329268317	C -> A	LOC_Os03g51140.1	intron_variant ; MODIFIER	silent_mutation	Average:56.428; most accessible tissue: Callus, score: 82.865	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329268317	NA	6.97E-07	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	5.14E-06	1.78E-08	mr1388	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	5.13E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	5.54E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	2.15E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.04E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.45E-08	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.18E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.34E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.02E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	8.02E-30	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	6.12E-06	2.28E-09	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	6.67E-06	9.61E-11	mr1742	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.22E-09	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	2.18E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	3.07E-06	mr1990	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.37E-09	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	6.51E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.15E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	6.14E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	7.00E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	9.98E-15	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	3.85E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	2.68E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329268317	NA	1.04E-19	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251