Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327442246:

Variant ID: vg0327442246 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27442246
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAATATATTCGATCATTGAATTTTGATTATTGATTTAATGAAACTAATTTGTTGTTGTAAATATGATTGTATTTAGGAAAAAGTACGAAATACCCCCT[G/A]
AACTATCGCGGTCGACCGAATTACCCTCCTAAATTCAAATAACGGATATTTTACACCATAAACTATACATACCGGACAAACGACCCCTAACACCGTTCTG

Reverse complement sequence

CAGAACGGTGTTAGGGGTCGTTTGTCCGGTATGTATAGTTTATGGTGTAAAATATCCGTTATTTGAATTTAGGAGGGTAATTCGGTCGACCGCGATAGTT[C/T]
AGGGGGTATTTCGTACTTTTTCCTAAATACAATCATATTTACAACAACAAATTAGTTTCATTAAATCAATAATCAAAATTCAATGATCGAATATATTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.80% 0.08% 0.00% NA
All Indica  2759 26.60% 73.30% 0.07% 0.00% NA
All Japonica  1512 98.80% 1.10% 0.13% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 33.30% 66.60% 0.17% 0.00% NA
Indica II  465 52.30% 47.70% 0.00% 0.00% NA
Indica III  913 7.90% 92.10% 0.00% 0.00% NA
Indica Intermediate  786 28.10% 71.80% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327442246 G -> A LOC_Os03g48200.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:80.194; most accessible tissue: Callus, score: 93.115 N N N N
vg0327442246 G -> A LOC_Os03g48220.1 downstream_gene_variant ; 2325.0bp to feature; MODIFIER silent_mutation Average:80.194; most accessible tissue: Callus, score: 93.115 N N N N
vg0327442246 G -> A LOC_Os03g48200-LOC_Os03g48220 intergenic_region ; MODIFIER silent_mutation Average:80.194; most accessible tissue: Callus, score: 93.115 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327442246 G A 0.1 0.08 0.07 0.06 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327442246 NA 2.88E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 1.03E-16 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 2.71E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 1.88E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 1.61E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 5.47E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 4.37E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 2.69E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 2.68E-18 mr1376 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 5.97E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 3.03E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 8.57E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 6.29E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 2.68E-18 mr1431 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 5.97E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 4.26E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 7.57E-10 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 4.98E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 9.14E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 1.45E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 1.65E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 5.91E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 4.11E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 6.68E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 2.46E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 8.16E-07 NA mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 5.60E-07 3.24E-13 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327442246 NA 8.27E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251