\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324647482:

Variant ID: vg0324647482 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24647482
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTCTAGTACAATGAATCTGGACAGAGATATGTCTAGATTCATAGTATTAGAATGTGTCATATCCAGTACAAGATTGATTTTTTATGGGACGGAGGGA[G/T]
TACGTACATTATGGATGCCCGCACGGAGGTAGTAGGACCGTACTACATTATGGATGCCCGCACGGATCGTAGGTACGTACCGGATGGGAGTGTACAATAC

Reverse complement sequence

GTATTGTACACTCCCATCCGGTACGTACCTACGATCCGTGCGGGCATCCATAATGTAGTACGGTCCTACTACCTCCGTGCGGGCATCCATAATGTACGTA[C/A]
TCCCTCCGTCCCATAAAAAATCAATCTTGTACTGGATATGACACATTCTAATACTATGAATCTAGACATATCTCTGTCCAGATTCATTGTACTAGAAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 6.10% 1.48% 0.00% NA
All Indica  2759 94.20% 5.50% 0.25% 0.00% NA
All Japonica  1512 87.70% 8.30% 4.03% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 89.20% 10.30% 0.50% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 93.90% 6.10% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.30% 0.38% 0.00% NA
Temperate Japonica  767 93.70% 2.30% 3.91% 0.00% NA
Tropical Japonica  504 85.70% 13.10% 1.19% 0.00% NA
Japonica Intermediate  241 72.60% 17.00% 10.37% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324647482 G -> T LOC_Os03g43920.1 downstream_gene_variant ; 2877.0bp to feature; MODIFIER silent_mutation Average:92.813; most accessible tissue: Minghui63 panicle, score: 98.869 N N N N
vg0324647482 G -> T LOC_Os03g43930.1 downstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:92.813; most accessible tissue: Minghui63 panicle, score: 98.869 N N N N
vg0324647482 G -> T LOC_Os03g43930.2 downstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:92.813; most accessible tissue: Minghui63 panicle, score: 98.869 N N N N
vg0324647482 G -> T LOC_Os03g43920-LOC_Os03g43930 intergenic_region ; MODIFIER silent_mutation Average:92.813; most accessible tissue: Minghui63 panicle, score: 98.869 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0324647482 G T 0.02 0.0 0.0 -0.04 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324647482 1.69E-06 NA mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 NA 6.52E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 6.56E-07 6.57E-07 mr1166_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 1.34E-06 3.65E-06 mr1306_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 1.02E-06 1.36E-07 mr1592_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 1.26E-06 NA mr1595_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 4.25E-06 3.66E-06 mr1597_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 NA 5.96E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 7.63E-06 7.63E-06 mr1710_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324647482 8.33E-07 8.34E-07 mr1783_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251