| Variant ID: vg0319121263 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19121263 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
ATCGGTCGCCATGCCGAGACAATATAAATCACTTAGATCAAAGTATATATTAACATGAAGATTATAAACGCATATAGCATAGCCGATCAAATAGATCTAG[C/T]
ATGTATCGGCTAATACTCCGATACCACTCTATATTAAGATATTAAAACAGATAGAATATATCAAACAGAAGCCTAATATACTTTATTGCGATAAGATCTT
AAGATCTTATCGCAATAAAGTATATTAGGCTTCTGTTTGATATATTCTATCTGTTTTAATATCTTAATATAGAGTGGTATCGGAGTATTAGCCGATACAT[G/A]
CTAGATCTATTTGATCGGCTATGCTATATGCGTTTATAATCTTCATGTTAATATATACTTTGATCTAAGTGATTTATATTGTCTCGGCATGGCGACCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 7.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.00% | 10.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.00% | 29.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319121263 | C -> T | LOC_Os03g33460.1 | upstream_gene_variant ; 4123.0bp to feature; MODIFIER | silent_mutation | Average:50.607; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg0319121263 | C -> T | LOC_Os03g33460-LOC_Os03g33480 | intergenic_region ; MODIFIER | silent_mutation | Average:50.607; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319121263 | NA | 1.93E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | 1.65E-08 | 1.20E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | 6.98E-06 | 1.46E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | 3.20E-06 | 2.67E-06 | mr1661 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | NA | 4.32E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | 1.72E-06 | 2.03E-09 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | NA | 9.33E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | NA | 1.18E-06 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | NA | 5.80E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319121263 | 9.82E-06 | 1.45E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |