\
| Variant ID: vg0317495339 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17495339 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTATAGTTTTAAACACAGTAAATCTTCTAAAAATCATAACTAATTCATCCGAGCTCCGTTTAAGCCCATTCAAGTCTCAGTAAATCAAGAAAACTGTG[C/T]
CGAATCCATTAAAATGGTTTTGTTCCCTGTTTCAGTAGTCTTATAGCCTGTTTGCAATGTTTGCTTTGTATGTCGCTAGATTCCGTTTCCTCCGACGCTC
GAGCGTCGGAGGAAACGGAATCTAGCGACATACAAAGCAAACATTGCAAACAGGCTATAAGACTACTGAAACAGGGAACAAAACCATTTTAATGGATTCG[G/A]
CACAGTTTTCTTGATTTACTGAGACTTGAATGGGCTTAAACGGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATTTACTGTGTTTAAAACTATACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 2.00% | 14.45% | 52.12% | NA |
| All Indica | 2759 | 2.60% | 0.00% | 14.90% | 82.49% | NA |
| All Japonica | 1512 | 88.80% | 6.20% | 3.64% | 1.32% | NA |
| Aus | 269 | 9.70% | 0.00% | 43.12% | 47.21% | NA |
| Indica I | 595 | 3.20% | 0.00% | 6.89% | 89.92% | NA |
| Indica II | 465 | 2.80% | 0.00% | 11.40% | 85.81% | NA |
| Indica III | 913 | 1.30% | 0.00% | 19.06% | 79.63% | NA |
| Indica Intermediate | 786 | 3.60% | 0.00% | 18.19% | 78.24% | NA |
| Temperate Japonica | 767 | 87.70% | 11.20% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 87.70% | 0.20% | 8.53% | 3.57% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.90% | 2.07% | 0.41% | NA |
| VI/Aromatic | 96 | 9.40% | 0.00% | 86.46% | 4.17% | NA |
| Intermediate | 90 | 37.80% | 2.20% | 20.00% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317495339 | C -> T | LOC_Os03g30710.1 | upstream_gene_variant ; 503.0bp to feature; MODIFIER | silent_mutation | Average:4.647; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0317495339 | C -> T | LOC_Os03g30700.1 | downstream_gene_variant ; 4809.0bp to feature; MODIFIER | silent_mutation | Average:4.647; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0317495339 | C -> T | LOC_Os03g30700-LOC_Os03g30710 | intergenic_region ; MODIFIER | silent_mutation | Average:4.647; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0317495339 | C -> DEL | N | N | silent_mutation | Average:4.647; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317495339 | NA | 3.16E-11 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 1.42E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 9.70E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | 7.60E-06 | 7.60E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 5.92E-09 | mr1515 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 2.89E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 2.95E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 1.43E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317495339 | NA | 3.12E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |