Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311959499:

Variant ID: vg0311959499 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11959499
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGTGGGCTGGTGCGCGCCGCCGCCGCCGCCGCCGTGGTGCTGGGGCGGCTGGTCTTGGCCATGGTGGCCGTGGTGCCCGAAGCCGAACATCTTGCTC[T/G]
CTTCGGGAGGTTTTGGGGAGGGTTGTGTTGTGTGAGTGTGATGGATCAAACGTGAGACGAGGCGATGAGAAGCTGCGCCTCCTTGGGGGTCCCCATTTAT

Reverse complement sequence

ATAAATGGGGACCCCCAAGGAGGCGCAGCTTCTCATCGCCTCGTCTCACGTTTGATCCATCACACTCACACAACACAACCCTCCCCAAAACCTCCCGAAG[A/C]
GAGCAAGATGTTCGGCTTCGGGCACCACGGCCACCATGGCCAAGACCAGCCGCCCCAGCACCACGGCGGCGGCGGCGGCGGCGCGCACCAGCCCACCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.00% 0.11% 0.25% NA
All Indica  2759 96.10% 3.50% 0.07% 0.33% NA
All Japonica  1512 0.50% 99.40% 0.07% 0.07% NA
Aus  269 29.00% 70.60% 0.37% 0.00% NA
Indica I  595 98.30% 1.20% 0.17% 0.34% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 94.70% 5.00% 0.00% 0.22% NA
Indica Intermediate  786 94.30% 5.20% 0.13% 0.38% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 36.70% 60.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311959499 T -> DEL N N silent_mutation Average:96.28; most accessible tissue: Zhenshan97 panicle, score: 99.79 N N N N
vg0311959499 T -> G LOC_Os03g21040.2 5_prime_UTR_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:96.28; most accessible tissue: Zhenshan97 panicle, score: 99.79 N N N N
vg0311959499 T -> G LOC_Os03g21040.3 5_prime_UTR_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:96.28; most accessible tissue: Zhenshan97 panicle, score: 99.79 N N N N
vg0311959499 T -> G LOC_Os03g21050.1 upstream_gene_variant ; 3014.0bp to feature; MODIFIER silent_mutation Average:96.28; most accessible tissue: Zhenshan97 panicle, score: 99.79 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0311959499 T G -0.02 -0.03 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311959499 NA 7.96E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 4.02E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 6.21E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.17E-60 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 6.68E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 2.21E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 8.15E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 8.32E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 4.75E-63 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 3.55E-83 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.71E-30 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.48E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.44E-23 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 6.16E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 2.27E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 9.62E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 9.83E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.50E-63 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311959499 NA 1.89E-101 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251