\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308360382:

Variant ID: vg0308360382 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8360382
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCAAGGGCACGCGCGGGGAGAGAGGGAGGGGGAACCGGTGGGCCGGGTCCACCTTGCGTGGCCCCGAGTGGGACCCGCTTGTCGGTGACACGGTTCAC[C/T]
GTGCGGAGGGAGCACGCGGCGGCGCGCTAGGGTTTAGGGGAGGGACGCGGTGCACGCGCGCGGCCCGCGGTGGGTGCGGATGCGGCGGGCCCACGCGCAG

Reverse complement sequence

CTGCGCGTGGGCCCGCCGCATCCGCACCCACCGCGGGCCGCGCGCGTGCACCGCGTCCCTCCCCTAAACCCTAGCGCGCCGCCGCGTGCTCCCTCCGCAC[G/A]
GTGAACCGTGTCACCGACAAGCGGGTCCCACTCGGGGCCACGCAAGGTGGACCCGGCCCACCGGTTCCCCCTCCCTCTCTCCCCGCGCGTGCCCTTGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 25.00% 11.36% 21.86% NA
All Indica  2759 44.60% 2.00% 18.45% 34.98% NA
All Japonica  1512 23.80% 72.50% 0.73% 2.98% NA
Aus  269 95.20% 0.40% 1.49% 2.97% NA
Indica I  595 23.50% 0.20% 36.30% 40.00% NA
Indica II  465 76.60% 1.10% 6.67% 15.70% NA
Indica III  913 38.10% 2.30% 16.87% 42.72% NA
Indica Intermediate  786 49.20% 3.40% 13.74% 33.59% NA
Temperate Japonica  767 42.10% 56.80% 0.65% 0.39% NA
Tropical Japonica  504 2.80% 88.10% 0.79% 8.33% NA
Japonica Intermediate  241 9.50% 89.60% 0.83% 0.00% NA
VI/Aromatic  96 83.30% 7.30% 6.25% 3.12% NA
Intermediate  90 53.30% 25.60% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308360382 C -> T LOC_Os03g15280.1 upstream_gene_variant ; 735.0bp to feature; MODIFIER silent_mutation Average:66.839; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg0308360382 C -> T LOC_Os03g15270-LOC_Os03g15280 intergenic_region ; MODIFIER silent_mutation Average:66.839; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg0308360382 C -> DEL N N silent_mutation Average:66.839; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308360382 C T 0.0 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308360382 NA 1.09E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 9.83E-11 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 6.69E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 3.47E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 7.03E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 8.56E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.27E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 6.35E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.46E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.38E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 4.38E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.36E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.79E-23 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.29E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 5.27E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.67E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 2.55E-06 1.99E-11 mr1779 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 1.23E-06 1.23E-06 mr1779 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 6.76E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 6.76E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 6.34E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.22E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.88E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 5.81E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.69E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 1.72E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.58E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 9.13E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 4.39E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308360382 NA 2.18E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251