Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232208358:

Variant ID: vg0232208358 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32208358
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTAGAAATTCGGATTTAATTACTAGGAATCTTATCCGTGTATTATATTTAATCATTTAGTCATAGACTAAATTAAATTGTATAATATTTCTAGGATTTC[G/A]
TCCGATATTTAGCTCGTAATAGAAATTTCTAACCTATTATATGGATATAATGCTCGGGGAGAGTAAATTAAAAACTTATGACAACGAAATAATTATACCC

Reverse complement sequence

GGGTATAATTATTTCGTTGTCATAAGTTTTTAATTTACTCTCCCCGAGCATTATATCCATATAATAGGTTAGAAATTTCTATTACGAGCTAAATATCGGA[C/T]
GAAATCCTAGAAATATTATACAATTTAATTTAGTCTATGACTAAATGATTAAATATAATACACGGATAAGATTCCTAGTAATTAAATCCGAATTTCTACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	8.00%	7.89%	10.16%	NA
All Indica	2759	66.20%	13.20%	11.05%	9.60%	NA
All Japonica	1512	99.10%	0.10%	0.66%	0.20%	NA
Aus	269	24.90%	4.50%	2.60%	68.03%	NA
Indica I	595	62.70%	15.00%	17.65%	4.71%	NA
Indica II	465	60.90%	4.90%	9.89%	24.30%	NA
Indica III	913	76.80%	14.90%	3.29%	5.04%	NA
Indica Intermediate	786	59.70%	14.60%	15.78%	9.92%	NA
Temperate Japonica	767	99.50%	0.10%	0.26%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	0.00%	3.32%	0.83%	NA
VI/Aromatic	96	29.20%	2.10%	46.88%	21.88%	NA
Intermediate	90	82.20%	2.20%	6.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232208358	G -> A	LOC_Os02g52660.1	upstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:12.336; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0232208358	G -> A	LOC_Os02g52670.1	upstream_gene_variant ; 3023.0bp to feature; MODIFIER	silent_mutation	Average:12.336; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0232208358	G -> A	LOC_Os02g52670-LOC_Os02g52680	intergenic_region ; MODIFIER	silent_mutation	Average:12.336; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0232208358	G -> DEL	N	N	silent_mutation	Average:12.336; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232208358	NA	6.09E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	4.69E-06	6.96E-07	mr1186_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	2.63E-07	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	2.69E-06	1.26E-06	mr1245_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	2.01E-06	mr1245_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	7.10E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	4.20E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	4.52E-06	8.22E-09	mr1371_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	4.43E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	8.62E-06	mr1397_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	5.31E-06	8.06E-07	mr1445_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	1.10E-06	mr1445_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	9.81E-07	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	6.29E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	7.44E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	8.47E-06	mr1616_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	1.71E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	5.34E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	5.91E-06	5.91E-06	mr1652_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	4.50E-06	1.01E-09	mr1655_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	2.70E-06	mr1655_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	5.29E-06	2.06E-08	mr1669_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	3.12E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	1.05E-06	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	1.02E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	NA	4.11E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	4.43E-06	NA	mr1982_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232208358	7.01E-06	7.01E-06	mr1982_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251