\
| Variant ID: vg0223506504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23506504 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTGCATATTTATTATTTCTAATTTAGCTATGCAGACATGACGTGTTTGTCTCCTGTCAGTAAATTAAGTTTCCTAATTTGATTTTGATTTCAAAGGCT[G/A]
CTGCGTAGCACGCATCAAAATCTAACTCCACGCTCTTTCACGTGTCCGATTCATAAAAACAGAATCAAAGAGTCAAGCTTTTACATATATTGTGATTAAA
TTTAATCACAATATATGTAAAAGCTTGACTCTTTGATTCTGTTTTTATGAATCGGACACGTGAAAGAGCGTGGAGTTAGATTTTGATGCGTGCTACGCAG[C/T]
AGCCTTTGAAATCAAAATCAAATTAGGAAACTTAATTTACTGACAGGAGACAAACACGTCATGTCTGCATAGCTAAATTAGAAATAATAAATATGCACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.80% | 0.30% | 0.57% | 55.42% | NA |
| All Indica | 2759 | 32.70% | 0.40% | 0.65% | 66.22% | NA |
| All Japonica | 1512 | 71.20% | 0.00% | 0.07% | 28.70% | NA |
| Aus | 269 | 1.50% | 0.00% | 1.49% | 97.03% | NA |
| Indica I | 595 | 50.60% | 0.20% | 0.17% | 49.08% | NA |
| Indica II | 465 | 38.70% | 0.20% | 0.86% | 60.22% | NA |
| Indica III | 913 | 17.20% | 0.00% | 0.66% | 82.15% | NA |
| Indica Intermediate | 786 | 33.60% | 1.30% | 0.89% | 64.25% | NA |
| Temperate Japonica | 767 | 80.70% | 0.00% | 0.13% | 19.17% | NA |
| Tropical Japonica | 504 | 55.80% | 0.00% | 0.00% | 44.25% | NA |
| Japonica Intermediate | 241 | 73.40% | 0.00% | 0.00% | 26.56% | NA |
| VI/Aromatic | 96 | 37.50% | 0.00% | 1.04% | 61.46% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 3.33% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223506504 | G -> A | LOC_Os02g38870.1 | upstream_gene_variant ; 802.0bp to feature; MODIFIER | silent_mutation | Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 | N | N | N | N |
| vg0223506504 | G -> A | LOC_Os02g38880.1 | downstream_gene_variant ; 1944.0bp to feature; MODIFIER | silent_mutation | Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 | N | N | N | N |
| vg0223506504 | G -> A | LOC_Os02g38860-LOC_Os02g38870 | intergenic_region ; MODIFIER | silent_mutation | Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 | N | N | N | N |
| vg0223506504 | G -> DEL | N | N | silent_mutation | Average:29.347; most accessible tissue: Minghui63 flower, score: 51.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223506504 | NA | 1.90E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 5.37E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 9.18E-06 | NA | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 2.88E-06 | 4.13E-08 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 3.38E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 5.74E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 1.17E-06 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 8.94E-07 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 8.26E-06 | NA | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 6.19E-06 | 7.07E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 2.13E-06 | NA | mr1146 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 3.52E-07 | 6.96E-07 | mr1146 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 2.18E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 1.76E-07 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 2.95E-08 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 2.56E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 9.37E-06 | 3.73E-07 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 1.57E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 4.03E-06 | 7.75E-07 | mr1868 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 5.77E-06 | mr1911 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 6.04E-09 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 5.52E-10 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 3.55E-07 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 9.13E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 1.69E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 5.78E-07 | NA | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 6.32E-08 | 1.85E-12 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 5.49E-06 | NA | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 1.16E-06 | 8.95E-11 | mr1075_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 4.28E-11 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 5.28E-06 | NA | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 1.81E-06 | 3.32E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 6.50E-07 | NA | mr1149_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 5.20E-07 | 4.05E-13 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 2.18E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 3.03E-08 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 6.47E-06 | NA | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | 3.47E-06 | 4.86E-13 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 4.80E-08 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 8.38E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 4.36E-09 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 7.90E-07 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 6.37E-07 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 8.75E-06 | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223506504 | NA | 7.13E-11 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |